WWW.HUBERT-BRUNE.DE
Kommentare zu Kommentaren im Weltnetz  Kommentare zu Kommentaren im Weltnetz  Kommentare zu Kommentaren im Weltnetz
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140

<= [1281][1282][1283][1284][1285][1286][1287][1288][1289][1290] =>

Jahr  S. E. 
 2001 *  1
 2002 *  1
 2003 *  1
 2004 *  3
 2005 *  2
 2006 *  2
2007 2
2008 2
2009 0  
2010 56
2011 80
2012 150
2013 80
2014 230
2015 239
2016 141
2017 150
2018 30
2019 18
 
S.
1
2
3
6
8
10
12
14
14
70
150
300
380
610
849
990
1140
1170
1188
 
P. Z.
 
100%
50%
100%
33,33%
25%
20%
16,67%
 
400%
114,29%
100%
26,67%
60,53%
39,18%
16,61%
15,15%
2,63%
1,54%
 
S.E. (S.)
T. (S.)
0,0039
0,0032
0,0030
0,0044
0,0047
0,0048
0,0049
0,0050
0,0044
0,0198
0,0384
0,0702
0,0819
0,1219
0,1581
0,1726
0,1869
0,1810
0,1734
 
K.  
1
1
1
3
2
2
2
4
0  
158
97
246
169
1614
1579
1950
1102
79
26
 
S.
1
2
3
6
8
10
12
16
16
174
271
517
686
2300
3879
5829
6931
7010
7036
 
P. Z.
 
100%
50%
100%
33,33%
25%
20%
33,33%
 
987,50%
55,75%
90,77%
32,69%
235,28%
68,65%
50,27%
18,91%
1,14%
0,37%
 
  K.  
S. E.
1
1
1
1
1
1
1
2
0
2,82
1,21
1,64
2,11
7,02
6,61
13,83
7,35
2,63
1,44
 
  K.  
T.
0,0039
0,0027
0,0027
0,0082
0,0055
0,0055
0,0055
0,0109
0
0,4328
0,2658
0,6721
0,4630
4,4219
4,3260
5,3279
3,0192
0,2164
0,0712
 
 K. (S.) 
S.E. (S.)
1
1
1
1
1
1
1
1,143
1,143
2,486
1,807
1,723
1,805
3,770
4,569
5,888
6,080
5,991
5,923
 
K. (S.)
T. (S.)
0,0039
0,0032
0,0030
0,0044
0,0047
0,0048
0,0049
0,0057
0,0050
0,0491
0,0693
0,1210
0,1479
0,4596
0,7225
1,0164
1,1362
1,0843
1,0316
* Von 2001 bis 2006 nur Gästebuch, erst ab 2007 auch Webforen und Weblogs.

NACH OBEN 1281) Urfaust, 17.08.2020, 01:09; Kathrina, 17.08.2020, 01:10; Herr Schütze, 17.08.2020, 01:38; Kathrina, 17.08.2020, 02:48; Herr Schütze, 17.08.2020, 16:00; Kathrina, 17.08.2020, 16:28; Herr Schütze, 17.08.2020, 16:43; Kathrina, 17.08.2020, 17:12 (7310-7317)

7310

@ Dietrich von Bern:

„@ Urfaust:

»Der Kommunismus war eiskalt geplant und mit allen Mitteln unterstützt, weil man ihn wollte und immer noch will, und deshalb verschweigt man die in seinen Namen ermordeten rd. 200 Millionen Menschen auch regelmäßig, oder man ›spielt sie herunter‹, bleibt jedenfalls immer ›blind auf einem Auge‹.« ** **

Richtig, er war eiskalt geplant ....

Im übrigen waren es nicht »nur« 200 Mio Menschen, sondern wohl mehr als 300 Mio. Menschen (weltweit), die zum Wohle des ‚Kommunismus/Sozialismus/Marxismus‘ über die Klinge springen mussten. Nachlesen kann man das beim Genozidforscher Prof. Rummel, Universität Honululu/Hawaii.“ **

Mehr als 300 Millionen ermordete Menschen! Vor ihrem Tod wurden sie wahrscheinlich noch als „Bourgeoises“ beschimpft, obwohl das einzige, was sie besaßen, eine Kuh war, wie in der sowjetischen Teilrepublik Ukraine, oder ein Schuh, wie in China, oder eine Brille, wie in Kambodscha, wo Brillenträger als „Intellektuelle“ und folglich ebenfalls als „Bourgeoises“ bezeichnet wurden.

Rummel kenn ich auch aus Heinsohns Buch „Söhne und Weltmacht - Terror im Aufstieg und Fall der Nationen“ (2003) (**), das Sie und Kathrina bereits erwähnten. Das Buch ist trotz einiger Schwächen wirklich zu empfehlen.

@ Kai Ahnung. **

Allen Unkenrufen zum Trotz werde ich mich nicht in „Ur-Unke“ umbenennen, weil ich dann zum Anglizisten würde, denn aus dem Namen „Ur-Unke“ würde bald durch das typisch anglizistische Weglassen des Bindestrichs der Name „Ur Unke“ werden, und diesen Anglizismus lehne ich total ab - Herr Urchrist und Frau Kathrina übrigens auch. Gut, ich hätte mit dem Namen „Ur Unke“ zwei Namen, einen Vornamen und einen Nachnamen, ich wäre also recht modern. Doch mir sind sowohl Vorname und Nachname als auch Modernität schnurzegal und Anglizismen sogar zuwider bis zum Erbrechen.

7311

@ Till Außenspiegel. **

Offiziell (ob auch tatsächlich, ist sehr fragwürdig) wählten 2017, von der Wahlbeteiligung von 76,2 Prozent ausgehend (also gleich 100 Prozent setzend, was nur legitim ist): 25,1 Prozent die CDU/CSU, 23,8 Prozent gar nicht (vgl. Wahlbeteiligung: 76,2 %), 15,6 Prozent die SPD, 9,6 Prozent die AfD, 8,2 Prozent die FDP, 7,0 Prozent die Linke, 6,8 Prozent die „Grünen“ und 3,9 Prozent sonstige Parteien. Die Regierungskoalition besteht also so gesehen aus einer Minderheit (40,7 Prozent CDU/CSU/SPD), ist schon allein deswegen verfassungswidrig, nennt sich aber verlogenerweise auch noch „Große Koalition“. Unter diesen Bedingungen könnten mit derselben Berechtigung auch die Nichtwähler, die AFD und die Wähler der sonstigen Parteien eine Koalition eingehen und regieren (37,3 Prozent), notfalls auch mit der FDP, dann hätten sie zusammen sogar 45,5 Prozent und damit 4,8 Prozent mehr als die angebliche „Große Koalition“.

Dazu kommt, daß diese Wahlergebnisse höchstwahrscheinlich eine Lüge sind, daß also stets zugunsten der CDU/CSU/SPD/FDP/„Grünen“/Linken-Blockpartei(en) gefälscht wird.

Viele haben Angst und wählen aus Gewohnheit wie zuvor. Das ist nicht richtig, auch nicht gut, aber ganz schwer zu ändern, weil sie Angst haben, völlig verunsichert sind. Angst ist etwas Irrationales, und wenn die die Entscheidung bei einer Wahl bestimmt, dann wird es sehr schwierig für die Nichtmainstreamler, die Verängstigten und Verunsicherten zu überzeugen. Dies alles ist aber selbst Teil des Plans. Die Angst und die Verunsicherung sind in der Kalkulation der Hintertanen enthalten und vergleichbar mit Chaos, das auch darin enthalten, ja sogar eines der bedeutendsten Etappenziele ist.

So funktionieren Wahlbetrug und Wählerbetrug im heutigen Westen, der sich früher mokierte über Wahl- und Wählerbetrug im kommunistischen Osten. Mittlerweile ist der Westen dabei, den damals kommunistischen Osten zu überholen.

7312

@ Urchrist:

„Wer nicht erpreßbar ist, hat keine Chance auf höhere Ämter. Sonst hätten wir nicht solche überwiegend Schwachmaten an entscheidenden Positionen.“ **

So ist es. Wer glaubt, daß hier auch nur ein Deut an Entscheidungen ohne Erpressungen getroffen wird, weiß nicht einmal ansatzweise, was geschieht. Die Korruption kann man doch mittlerweile sogar riechen. Der ganze Mist stinkt zum Himmel. Kein Mensch kommt ohne Korruption in ein Amt. Korruptionslosigkeit ist einfach nicht mehr möglich. Die Spatzen pfeifen es bereits von den Dächern.

7313

@ Paulinchen. **

Vielen Dank für den Kommentar, liebes Paulinsche, der mir sehr aus der Seele spricht. Weil der ganze Planet Erde voll ist mit diesem Mist aus Korruption, Anarchie, könnten wir es uns sparen, auf bestimmte Täter hinzuweisen, wenn es nicht trotzdem nötig wäre. Es wird noch mehr Chaos geben. Das ist beabsichtigt. Deshalb können und sollten wir wenigstens zuhause, als Ehepaar, in der Familie, in der Nachbarschaft, in der Widerstandsbewegung zusammenhalten und Einigkeit zeigen.

7314

@ Vera Lengsfeld:

„Allerdings sollte die Antifa ganz vorsichtig sein. Die Postkarte mit dem Lennon-Zitat ist noch in meinem Besitz. Falls Ono diese Postkarte zu Gesicht bekommen und feststellen sollte, dass keine Genehmigung zur Verbreitung dieses Lennon-Ono-Zitats eingeholt und die entsprechende Gebühr bezahlt wurde, kann das teuer werden.“ **

Aber auch für Ono kann es sehr teuer werden, wenn sie sich mit der „Antifa“ anlegt, denn die Antifa ist ja Soros' „Antifa“.

7315

@ Vera Lengsfeld:

„Was würde eigentlich John Lennon sagen, wenn er davon erführe? Lennon startete als Anti-Establishment-Künstler und träumte von einer Welt ohne Grenzen und Eigentum.“ **

Kommunismus und Kapitalismus sind ja auch verheiratet. Warum sollte John Lennon nicht Yoko Ono heiraten? Das ist typisch für Linke, denn Linke sind so geldgeil wie diejenigen, die sie zu bekämpfen vorgeben. Beide sind miteinander verheiratet.

7316

Erinnert sei an Mick Jaggers Verbot, das er vor einigen Wochen gegenüber Trump aussprach: Trump dürfe bei seinem Wahlkampf Musik der Rolling Stones nicht verwenden.

Andere, die sich gern immer wieder im Sinne der Globalisten aussprechen, sind Marius Müller-Westernhagen und Wolfgang Niedecken. Soll man jetzt die Schallplatten aus deren Frühzeit, als sie noch ehrlicher waren, verbrennen?

7317

@ Wolfgang Hebold:

„Analphabeten können nicht Programmieren.“ **

Das wäre mir an Ihrer Stelle aber sehr peinlich. In Ihrem Satz ist das Wort „programmieren“ ein Verb (Tuwort, Tätigkeitswort) und darum hat der Anfangsbuchstabe klein zu sein. Für Verben gilt die Kleinschreibregel.

Außerdem ist das Verb „können“ ein Hlfsverb, und Hilfsverben können (!) nicht direkt in Verbindung mit Substantiven (Nomen, Hauptwörtern) stehen, sondern nur mit Verben, weshalb man auch mittels dieser Regel erkennen kann (!), daß (ich schreibe nach der alten Rechtschreibregelung, weil die neue ein Witz, ein schlechter Witz ist) z.B. in Ihrem Satz das mit dem Hilfsverb in direkter Verbindung stehende Wort nur ein Verb sein kann (!).

Es tut mir leid, aber Ihr Fehler ist so peinlich. Obendrein ist Ihr Thema augerechnet auf Grammatik und Rechtschreibung bezogen. Sehr peinlich!

Selbst dann, wenn Sie das Wort absichtlich nicht gemäß der Rechtschreibregelung geschrieben haben sollten, bleibt die Peinlichkeit. Man sollte damit nicht spielen, wie es die Werbung seit Jahrzehnten tut, und zwar seit Bestehen des Internets. Das ist kein Zufall. Das Internet hat die Leute versaut. Denken Sie doch an die Kinder und an deren Schulpflicht und Schulfächer, von denen eines der zwei Hauptfächer das Sprachliche und darum auch die Rechtschreibung ist.

 

NACH OBEN 1282) Herr Schütze, 18.08.2020, 01:57 (7318)

7318

@ Wolfgang Hebold:

„Programmiersprachen basieren zwar auf einem Grundvokabular, das aus dem Englischen stammt. Allerdings handelt es sich nur um relativ wenige Worte wie if, while oder switch. Zu sagen, eine Programmiersprache wie C wäre Englisch, ist daher kaum sinnvoll; es ist eine eigene Sprache; es ist eine Sprache, die von ihrem besonderen Schriftbild, ihrer Rechtschreibung und einer formalen Grammatik beherrscht wird. Sie zu erlernen setzt ein allgemeines, abstraktes Verhältnis zu diesen drei Elementen einer Sprache voraus. Trotzdem könnten Sprachen mit einer Betonung des Schriftbilds, Sprachen mit einer verwirrenden Rechtschreibung, Sprachen mit einer subtilen Grammatik wirksamer sein als andere Sprachen. Und wer wollte bezweifeln, dass das Deutsche wenigstens zwei der genannten drei Elemente sicherlich bietet: Eine Wirrwarr an Rechtschreibregeln und eine hochkomplexe Grammatik. Könnte es sein, dass diese scheinbaren Nachteile unserer Sprache sich langfristig womöglich als Vorteil erweisen?? Dann hätte diese große europäische Sprache noch eine andere Zukunft, die man von ihr auf den ersten Blick nicht erwartet.“ **

Ich habe mich an der Universität mit der Beziehung zwischen natürlichen und künstlichen Sprachen beschäftigt. Das ist lange her. Wir waren aus drei verschiedenen Disziplinen zusammengekommen - Physik, Mathematik, Linguistik - und begannen dann u.a. damit, die 1971/’72 entwickelte Programmiersprache „Prolog“ näher unter die Lupe zu nehmen.

Rekursion gibt es in allen Sprachen, ist ein Bestandteil der Grammatik, den besonders Linguisten, Logiker und Mathematiker kennen.

Etwas anderes ist das, was ich befürchte, nämlich die in den menschlichen Körper eingebaute bzw. eingespritzte fremde „Hardware“, in der eine „Software“ enthalten ist, die keine Wahl mehr erlaubt.

 

NACH OBEN 1283) Kathrina, 19.08.2020, 03:58, 19:21; Herr Schütze, 19.08.2020, 20:00; Kathrina, 19.08.2020, 20:20; Wirtschaftshistoriker, 19.08.2020, 21:56; Kathrina, 19.08.2020, 23:58; (7319-7324)

7319

Sozialamt der Welt
Wenn die Ungarn so sehr von sich überzeugt sind und sich rühmen, „politisch und wirtschaftlich vorangekommen“ zu sein, so, als hätten sie es nur sich selbst zu verdanken (und nicht Deutschland, das ja als Sozialamt der Welt alle und jeden bezahlt und hilft), den Westen den Untergang attestiert, es aber unterläßt, aus der EU auszutreten, dann ist die Argumentation dieser Ungarn schwach. Diese Argumentation würde erst stark werden können, wenn die Ungarn aus der EU austreten würden. Interessanterweise ist aber nicht Ungarn, sondern England, also ein westliches Land, aus der EU ausgetreten. Die Wahrheit ist, daß Ungarn und all die anderen Staaten an der neuen EU-Ostgrenze ohne die EU (= Deutschland, EU-Motor, Zahlweltmeister und Sozialamt der Welt), ihren politischen und vor allem ihren wirtschaftlichen Aufschwung noch nicht einmal ansatzweise hätten wahrnehmen können, sondern - ganz im Gegenteil - ihre Länder noch weiter und noch schneller als zuvor schon von ihrem ohnehin immer schon sehr schwachen Wirtschaftsstand abgerutscht und ihre Bevölkerungen in noch größerer Zahl und ebenfalls viel schneller als zuvor schon in den Westen (v.a. nach Deutschland natürlich) ausgewandert wären.

Sobald gerade diese neuen Staaten an der neuen EU-Ostgrenze zu Mitgliedern der EU geworden waren, wurden sie immer selbstbezogener und frecher, kassierten weiterhin ab und meckerten, drohten sogar und kassierten noch mehr ab. Und Deutschland bezahlt den ganzen Wahn - und nicht nur den, sondern allen und jeden, weil es das Sozialamt der Welt ist!

Wenn überhaupt ein Staat, dann ist die Bundesrepublik Deutschland der einzige Staat, der diesen Wahn beenden könnte. Bis heute ist es jedoch so, daß der einzige Staat, der diesen Wahn mit weitem Abstand am meisten unterstützt und sich dabei selbst immer mehr erniedrigt, ebenfalls die Bundesrepublik Deutschland ist.

Ich habe der EU noch nie getraut, auch nicht ihren Vorläufern (Montanunion, EWG, EG), weil sie nur einen Zweck erfüllen soll, den auch der Euro, und zwar in einem noch schlimmeren Ausmaß, erfüllen soll: den Ausverkauf Deutschlands, das von Anfang an der Zahlweltmeister und das Sozialamt der Welt war und ist.
EU
EU ?  NEIN !
Euro ?  NEIN !
 –  2001, drei Jahre vor dem Beginn der EU-Osterweiterung, las ich ich wegen einer Buchveröffentlichung bei www.Hubert-Brune.de: „Plan einer EU-Reform. Besser als eine EU-Reform ist nur noch der EU-Tod (EU = Europas Untergang).  –  Mein Vorschlag, wie man die EU für die Zukunft stabiler machen muß, bedeutet, daß die momentane katastrophale Entwicklung der EU gestoppt werden muß, um zu verhindern, daß sie dem Imperium der USA oder (was noch viel schlimmer wäre) dem Rest der Welt (mit antiken Worten: »den Barbaren«) geopfert wird.“ (**). „Ohne Deutschland ist Europa tot!  –  Der EU-Kern umfaßt 1.) den inneren Kern (Deutschland, Frankreich), 2.) den äußeren Kern (Niederlande, Belgien, Luxemburg, Österreich, Schweiz [falls gewollt][**]), 3.) die EU-Hülle mit Ringen: a.) Ring des inneren Freihandels (Nord-, Nordwest-, Süd-, Südwesteuropa), b.) Ring des äußeren Freihandels (Ostmittel-, Osteuropa), c.) Ring der Assoziierten (Südost-, evtl. Osteuropa). Der größte Teil Osteuropas und Südosteuropa gehören nur geographisch, jedoch nicht kulturell zu Europa, zum Abendland.“ (**). Das las ich 2001. Der „EU-Tod“ ist mittlerweile mein Wunsch, weil ich - wie Hubert Brune („EU = Europas Untergang“) - Europa retten will.

7320

@ Hartwig. **

Fakt ist, daß Sie mich überhaupt nicht verstanden haben, und zwar nicht nur deswegen, weil Sie kein Wirtschaftswissenschaftler und auch kein Politologe sowie - noch wichtiger - kein Historiker (speziell Wirtschaftshistoriker) sind.

EU
EU
EU

Außerdem habe ich sehr wohl bemerkt, daß diese Bundesrepublik behindert, nämlich sich selbst, aber Sie haben auch das überhaupt nicht verstanden, wahrscheinlich noch nicht einmal gelesen!

Ich habe gesagt:

„Wenn überhaupt ein Staat, dann ist es die Bundesrepublik Deutschland der einzige Staat, der diesen Wahn beenden könnte. Bis heute ist es jedoch so, daß der einzige Staat, der diesen Wahn mit weitem Abstand am meisten unterstützt und sich dabei selbst immer mehr erniedrigt, ebenfalls die Bundesrepublik Deutschland ist.“ ** **

Damit ist nicht gesagt und auch nicht gemeint, daß die Bundesrepublik nichts behindert. Im Gegenteil: Die Bundesrepublik behindert mit allem, was sie tut, letztlich immer nur sich selbst. Die Behinderung erfolgt ja gerade über die Widersprüchlichkeit, die aber letztlich Deutschland alleine betrifft. Die Deutschen (Steuerzahler [gehören Sie dazu?]) bezahlen alle und jeden und alles und jedes und gehen dabei selbst nicht nur leer aus, sondern haben nur Nachteile dadurch. Bei mehr als 90% aller EU-Mitglieder ist es genau umgekehrt. Auch das habe ich am Beispiel EU-Oststaaten in meine Kritik miteinfließen lassen:

„Die Wahrheit ist, daß Ungarn und all die anderen Staaten an der neuen EU-Ostgrenze ohne die EU (= Deutschland, EU-Motor, Zahlweltmeister und Sozialamt der Welt), ihren politischen und vor allem ihren wirtschaftlichen Aufschwung noch nicht einmal ansatzweise hätten wahrnehmen können, sondern - ganz im Gegenteil - ihre Länder noch weiter und noch schneller als zuvor schon von ihrem ohnehin immer schon sehr schwachen Wirtschaftsstand abgerutscht und ihre Bevölkerungen in noch größerer Zahl und ebenfalls viel schneller als zuvor schon in den Westen (v.a. nach Deutschland natürlich) ausgewandert wären.“ ** **

Wenn es wirklich so wäre (man beachte den Konjunktiv), daß ein EU-Mitglied einer Behinderung unterläge, wie es tatsächlich aber nur für Deutschland der Fall ist, dann bliebe diesem EU-Mitglied doch jederzeit die Möglichkeit, aus der EU auszusteigen. Einen Ausstieg aus der EU wollen aber fast alle EU-Mitglieder wegen ihrer Vorteile nicht, während einige wenige EU-Mitglieder (allen voran Deutschland, zum wesentlich geringeren Teil auch Österreich, Dänemark, Schweden, Holland, Belgien, Luxemburg) wegen ihrer Nachteile das nicht dürfen. Es hat noch nie eine Wirtschaftsunion gegeben, in der alle nur genommen und keiner gegeben hat oder in der alle nur Vorteile oder alle nur Nachteile gehabt haben. Wir zahlen! Basta! Fakt! Doch eine so einfache Logik verstehen Sie ja nicht.

Ungarn und die anderen EU-Oststaaten können doch die EU verlassen. Dann würden sie auch ihre sowieso nur eingebildete „Behinderung“ nicht mehr ertragen müssen (*HEUL*). Sie haben nur Vorteile durch die EU, und zwar die meisten Vorteile von allen! Fakt! Deswegen kann ich mich immer schön zurücklehnen und immer wieder sagen: Mehr als 90% der EU-Mitglieder werden nie die EU verlassen, solange Deutschland sie nicht verläßt. Sie wehren sich nur politisch, weil sie die politischen Umstände der EU nicht teilen wollen. Das ist alles! Tun Sie nicht so, als wüßten Sie sogar das nicht.

Diese EU-Oststaaten hätten gar kein Chance, auf dem Markt zu bestehen, wenn sie nicht von Anfang an von Deutschland unterstützt worden wären. Das ist belegbar, deutlich belegbar.

Wenn Sie lieber der Bunderepublik Deutschland die Schuld geben für alles, was heute so anfällt, dann befinden Sie sich mitten in den Mainstreammedien, gehören also zu denen, die nicht nur eindeutig gegen Deutschland, sondern genauso eindeutig gegen Europa sind.

Kommen Sie mir jetzt nicht mit dem billigen „Export“-Argument. Wieder Mainstreammedien! Die bei uns ansässigen Globalunternehmen haben mit unserem Staat gar nichts mehr zu tun - außer der Tatsache, daß auch sie Geld vom Staat einfordern und es auch bekommen, weil die deutschen Steuerzahler es bezahlen. Wenn ich also in diesem Zusammenhang von „uns“ spreche, dann meine ich die deutschen Steuerzahler und nicht die Globalunternehmen und auch nicht die Parallelgesellschaft der Politiker. Und die EU-Oststaaten können ebenfalls exportieren, weil es Deutschland gibt, das das unterstützt und verstärkt. Das sind Tatsachen. Und die sind auch der Grund, weshalb die EU-Oststaaten die EU niemals verlassen werden.

Die EU hätte das, was wir sogar auf den Straßen täglich sehen, niemals zugelassen, wenn die EU-Oststaaten nicht in der EU wären. Und genau das nutzen diese Staaten aus. Sie wissen, daß Deutschland sowieso bezahlt. Sie nutzen diese Tatsache aus und erpressen Deutschland zudem über die EU. Das weiß jedes Kind! Aber Sie nicht.

7321

@ Adorján Kovács. **

Das, was Sie sagen, ist nicht wahr, entspricht nicht den Tatsachen. Es ist eine Strategie, die auch Sie - wie ihre Landsleute und alle anderen Osteuropäer - hier fahren und die auch von allen anderen „Freunden“ der Deutschen gefahren wird. Die EU ist - wie die NATO und die UNO (Feindstaatenklausel!) auch - gegündet worden, um Deutschland (damals noch nur Westdeutschland) ausbeuten zu können. Kathrina hat völlig recht.

„Die NATO wurde gegründet, um in Europa die Amerikaner drinnen, die Russen draußen und die Deutschen unten zu halten.“ (Hastings Ismay als 1. Generalsekretär der NATO).

„Der Euro ist wie Versaiiles ohne Krieg.“ (François Mitterrand).

Schön ruhig haben sich die heutigen EU-Oststaaten verhalten, als sie noch keine EU-Mitglieder waren. Und das soll neuerdings nur deshalb anders sein, weil sie sich jetzt politisch zu wehren hätten? Das Gegenteil ist richtig! Damals konnten sie sich noch nicht wehren, weil sie sonst nicht in die EU aufgenommen worden wären; heute wehren sie sich, weil sie in der EU sind und nur darum ständig meckern und erpressen können, denn ihre Mitgliedschaft verhindert den Rauswurf aus der EU.

Der deutsche Steuerzahler aber muß nicht nur alles bezahlen, sondern sich auch noch diese völlig an den Haaren herbeigezogene Kritik dieser EU-Ostgrenzmärker erdulden. Das ist Hohn und Spott!

Die heutigen EU-Oststaaten wären wieder ganz ruhig, wenn sie die EU verlassen müßten.

Geht doch endlich hinaus aus der EU!

Ich wünsche mir nichts mehr zum Namenstag, nichts mehr zum Geburtstag, nichts mehr zu Weihnachten. Ich wünsche mir nur das Ende der EU.

7322

Die folgende Frage muß erlaubt sein:

Welche Alternativen können uns denn die EU-Oststaaten und die EU-Südstaaten bieten? KEINE einzige.

Die Logik, nach der es weitergehen wird, ist die, mit der es schon angefangen hat.

Ohne Deutschland ist die EU nichts. Also hängt der Aufstieg und der Fall der EU nur von Deutschland ab. Angesichts der Weltwirtschaftskrise steigt die Wahrscheinlichkeit für den Zusammenbruch der EU, den ich mir sehnlichst wünsche. Keine Nation, sondern die EU ist der Diktator. 90 Prozent der Gesetze kommen von der EU. Sie macht den Mitgliedern Schwierigkeiten. Aber statt den Ausstieg zu wagen, stürzen sich die Geldgierigen auf Lügen, um weiterhin abzocken zu können.

7323

Ich habe im Gegensatz zu Hartwig Wirtschaft und Geschichte studiert.

Meinetwegen können er und andere ihre Ideologie mit den nationalsozialistisch operierenden Visegrad-Staaten teilen, aber mit Wirtschaft hat das nichts zu tun.

Ihr Einsaz für Fremde und das Fremde in Ehren (ist ja auch im Ausplünderungsplan mitenthalten), nützt uns deutschen Steurzahlern aber überhaupt nichts. Für uns hat seit 102 Jahren niemand gesprochen, geschweige denn auch nur einen Finger gekrümmt.

EUdSSR
Ideal und real existierende EUdSSR.
EUdSSR
Flagge der real
existierenden
EUdSSR.
Niemand kann die durch die EU und besonders den Euro verursachte Verarmung der Deutschen bestreiten. Man kann es seit langem schon auch auf der Straße sehen.

Die Ausplünderung Deutschlands, die schon seit 1918 anhält und seitdem immer schlimmer, immer menschenfeindlicher geworden ist (beispiellos in der Geschichte), ist eine historische Tatsache.

Was die EU diktiert, wird gemacht. Alle EU-Präsidenten-Darsteller und EU-Kommissare-Darsteller waren und sind keine Wirtschaftswissenschaftler, haben von Wirtschaft zumeist sogar überhaupt keine Ahnung, bringen Gesetze hervor, die sie selber nicht durchschauen, die aber Gültigkeit bekommen. Die EU ist eine reine Kommandozentrale, die EU-Politik ein rein politischer Dirigismus, wie man ihn aus der Kommunistenwelt kennt, weshalb das Kürzel „EUdSSR“ in Anlehnung an die UdSSR längst berühmt geworden ist. Von Wirtschaft verstehen also auch die EU-Kommandanten rein gar nichts.

Worüber hier geredet wird, hat in erster Linie mit Politik zu tun, genauso wie in der EU selbst, die auch mittels Politik - und zwar eine, die vom Geld totalitär beherrscht wird - lediglich die privaten Interessen von Politikern und deren Geldgebern („Lobbyisten“) diktatorisch durchsetzt.

Das alles pfeifen doch die Spatzen längst von den Dächern. Um das zu wissen, braucht man noch nicht einmal Wirtschaft und Geschichte studiert zu haben. Und Sie haben nichts Besseres zu tun, als die gegen uns Steuerzahler gerichtete Politik auch noch zu unterstützen. Ich hoffe, Sie sind nicht aus der AfD.

Seit nunmehr 102 Jahren bezahlt der deutsche Steuerzahler „als Sozialamt der Welt alle und jeden“ (**|**), wie Kathrina richtig gesagt hat. Der Grund ist ein politischer (kriegerischer), der enorme Auswirkungen auf die Wirtschaft hatte, hat und haben wird (hoffentlich nicht mehr lange). Die Wirtschaft kann nicht in den Himmel wachsen, was übrigens ausgerechnet Wirtschaftsnobelpreisträger zu glauben scheinen; ein Volk kann nicht ewig bezahlen (ob mit Geld oder mit Blut), was geldgierige Politiker und Ideologen zu glauben scheinen; und die Ressourcen dieser Erde sind auch nicht unbegrenzt, was ausgerechnet diejenigen Politiker, die sich „grün“ geben, am meisten zu glauben scheinen.

7324

@ Herr Schütze. ** **

Danke, Herr Schütze, für Ihre Unterstützung.

Mir geht es so wie Ihnen, denn auch ich wünsche mir nichts mehr als nur das eine: das Ende der Bevormundung, ob es Masken, Impfungen, Einwanderungen, Rettungsschirme, Genderwahn, Euro und eben diese kommunistische EU betrifft.

 

NACH OBEN 1284) Kathrina, 20.08.2020, 14:39, 15:00; Herr Schütze, 20.08.2020, 17:41; Kathrina, 20.08.2020, 18:18; Herr Schütze, 20.08.2020, 19:36; Kathrina, 20.08.2020, 20:21; Herr Schütze, 20.08.2020, 21:08; Kathrina, 20.08.2020, 21:50; Herr Schütze, 20.08.2020, 22:30; Kathrina, 20.08.2020, 23:23 (7325-7334)

7325

Einen geschriebenen Text zu „hören“ (**), ist schwer. Haben Sie schon einmal schriftlichen Text gehört?

Soviel zu Ihren Anglizismen, die Teil des Verdummungsprojekts sind, das gegen uns läuft.

Hankel kenne ich sehr gut. Er sagt genau das, was ich auch sage, z.B. auch darüber, daß die Globalunternehmen (vorausgesetzt, Sie wissen überhaupt, was ich damit meine!) ihre Bilanzen fälschen, auch fälschen dürfen.

Den deutschen Steuerzahlern wird alles aufgebürdet, und zwar durch Zwangserlasse, die direkt aus der EU kommen und von den deutschen Politikerdarstellern nur noch abgenickt werden, während diese gleichzeitig allen Globalunternehmen in Deutschland ebenfalls alles auf Kosten der Steuerzahler versprechen, so daß die Globalunternehmen nicht nur keine Steuern zahlen, sondern auch ihre Bilanzen fälschen dürfen und sogar auch den Unterschied zwischen den erfundenen und dennoch als Opportunitätskosten verbuchten Löhnen billiger Arbeiter (z.B. aus Indien oder Takatukaland) und dem Lohn eines deutschen Arbeitnehmers von eben den deutschen Steuerzahlern bezahlt bekommen, was u.a. bedeutet, daß die deutschen Arbeitnehmer in Globalunternehmen sich einen Großteil ihres Lohnes selbst wegnehmen - gezwungenermaßen natürlich.

Wer das nicht wahrhaben will, soll hier nicht herumprosaunen über „Benachteiligungen anderer“. Gibt es hier denn nur noch Kommunisten?

Wenn ich wirtschaftlich von Deutschland spreche, dann kann ich nur diejenigen meinen, die auch an der deutschen Wirtschaft samt Steuern beteiligt sind, und das sind nur die, die auch Steuern zahlen. Nicht beteiligt daran sind somit z.B. die in Deutschland ansässigen, früher auch nationalen, heute aber nur noch internationalen Globalunternehmen, und zwar nicht obwohl, sondern weil sie in Deutschland ansässig sind, denn sie lassen sich diesen angeblichen, aber rein theoretisch riesigen „Verlust“ gut bezahlen - auf Kosten der deutschen Steuerzahler natürlich (siehe oben).

WER „hört“ (**) Ihren Texten eigentlich zu?

7326

Wilhelm Hankel sagte im Januar 2010 in einem Gespräch („Ende der Krise ist nicht in Sicht“, Gespräch in: Zuerst!, Januar 2010):

„Deutschland zum Beispiel gehört zu diesen automatischen Kreditgebern .... Richtig. Neben Deutschland gibt es nur drei weitere Überschußländer in der Euro-Zone: Niederlande, Österreich und Finnland. Deutschland bringt etwa 90 Prozent der Überschüsse der Euro-Zone. Wenn von den 16 Ländern der Euro-Zone zwölf seit langem defizitär sind und jetzt auch noch als überschuldet gelten, dann ist Deutschland nicht nur der Bankier der Euro-Zone. Der Bankier muß, so ist zu befürchten, jetzt auch noch für die Entschuldung der Euro-Bankrotteure aufkommen. Das steht nicht im Vertrag zur Währungsunion. .... Dem Vertrag nach sollte die Euro-Zone eine »Stabilitätsgemeinschaft« sein. De facto ist sie jedoch zu einer »Haftungsgemeinschaft« geworden mit einem Hauptgaranten: Deutschland! Das ergibt sich aus der Logik des gemeinsamen Geldmarktes und der gleichen Kreditfähigkeit aller Euroländer bei der EZB.

Letztlich ist es Deutschland, das mit seiner Wirtschaftskraft und –leistung die Kreditfähigkeit der Euro-Zone und die Stärke des Euro an den internationalen Finanzmärkten ermöglicht.

....

Das Gemeineigentum an der Währung: 16 Staaten, ein Geld, hat genau das bestätigt, wovor gute Europäer, nämlich wir, die Euro-Kritiker, von Anfang an gewarnt haben: Was allen gehört, gehört niemandem und wird von niemandem gepflegt. Im Gegenteil: Man überläßt die Pflege »den anderen« oder »der Allgemeinheit«. Genau das haben die 13 Euro-Trittbrettfahrer getan – die Pflege des Euro und die Einhaltung der feierlich beschworenen Spielregeln haben sie im wesentlichen Deutschland überlassen! Das Resultat liegt vor.

Es sind die Probleme einer gemeinsamen Viel-Völker-Währung, die unter den Währungspartnern Spannungen und Konflikte auslösen. Eine Vielheit nationaler Währungen, die im Wettstreit und Wettbewerb miteinander stehen, tut das nie.

....

Der Euro belohnt die Mißwirtschaft der »PIGS« und anderer EUZ- und Euro-Länder, und er verstärkt die Schuldenlast gesunder Länder wie Deutschland.

Der Einfluß des großen Geldes auf die Politik war schon immer ebenso groß wie geheim. Doch manchmal fällt ein erhellender Lichtstrahl darauf, wenn z.B. die Bundeskanzlerin den Chef der größten Bank in Deutschland zu einer kleinen Geburtstagsfeier ins Kanzleramt einlädt.

Aber die Kanzlerin argumentiert, die Privatbanken müßten unterstützt werden, da ein Zusammenbruch des Privatbankensektors eine Systemkrise auslösen würde .... Das gilt für keine Bank – nur die Zentralbank. Nur wenn diese zusammenbrechen sollte, droht eine Systemkrise. Das war zuletzt im 18. Jahrhundert der Fall, als in Frankreich die Königliche Bank zusammenbrach und indirekt dazu beitrug, die französische Revolution auszulösen. Der Zusammenbruch von »Lehman Brothers« hat keine Systemkrise in den USA herbeigeführt. Er war die Folge einer Krise, nicht ihr Auslöser.

....

Noch gibt es keinen Marktversorger, dessen Ausfall irreparable Systemschäden verursachen könnte. Aber zu solchen Schäden könnte es kommen, wenn der Staat fortfährt, immer nur die Großen zu retten und die Kleinen ihrem Schicksal überläßt. Dann geht mit dem Mittelstand auch die Marktwirtschaft zugrunde, und wir bekämen eine Staatswirtschaft wie in der alten UdSSR oder im heutigen China!

....

Zentrum und Auslöser der weltweiten Finanzkrise ist die Globalisierung der privaten Großbanken oder wie man früher sagte Hochfinanz.

....

Die Privatbanken schufen sich an diesen Finanzoasen eigene Geldbeschaffungsmärkte und dazu Produkte, die man an solchen Plätzen im großen Stil handeln konnte. Dies haben die nationalen Aufsichtsbehörden zwar immer gesehen, aber niemals verhindert. Warum ist das nicht geschehen? Jede Krise im Finanzsektor ist die Folge von neuartigen, »innovativen« Finanzprodukten und -geschäften, die man bislang nicht kannte und deren Folgen man deswegen auch nicht abschätzen konnte. Jede Aufsicht orientiert sich rückwärts an den Erfahrungen aus der letzten Krise. Da es aber bei der letzten Krise diese neuen Produkte noch nicht gab, war die Aufsicht überfordert. So einfach ist das.

....

Kein Staat kann seine Bürger endlos belasten. Irgendwann und irgendwo ist die Grenze erreicht, schon aus Gründen der Handlungsfähigkeit des Staates. Er darf nicht zur Zins-Bedienungs-Maschine werden!

....

Am Ende steht nicht die Marktwirtschaft, sozial oder weniger, sondern die Staatswirtschaft à la China.“ **

Wie gesagt: Das sagte Hankel 2010.

7327

Alle globalistischen Unternehmen haben mit den Nationen nichts mehr zu tun. Sie wären keine globalistischen Unternehmen, wenn sie immer noch einer Nation verpflichtet wären. Das sagt doch schon die Bedeutung von „globalistischen Unternehmen“. Wenn aber ein BIP von den entsprechenden „Experten“ „zusammengezählt“ wird und auf jeden einzelnen Menschen der Nation, in der dieses Unternehmen einfach nur ansässig ist, „umgerechnet“ wird, haben wir es mit einer absichtlich erstellten Milchmädchenrechnung zu tun, denn die Angaben für das BIP PRO KOPF sind FALSCH. Das hat übrigens auch Wilhelm Hankel gesagt. Die Bilanzen werden gefälscht, wie die Wahlergebnisse gefälscht werden. Auch das hat Wilhelm Hankel gesagt. Und ich sage dies hier nur, weil Kathrinas Aussagen richtig sind und hier auch von Wilhelm Hankel die Rede war, der Kathrinas Aussagen ebenfalls als richtig bestätigt.

7328

Söders Frau verkauft Mund-Nasen-Masken (MNM). Alles klar?

Die US-Politiker haben sich schon abgesichert. In den USA ist nämlich schon per Gesetz geregelt, daß für die durch Impfungen verursachten gesundheitlichen Schäden der US-Staat bzw. die US-Staaten nicht in Haftung genommen werden dürfen. Ganz nüchtern betrachtet bedeutet das zweierlei: (1.) Diese Geldgierigen gehen von einer Zwangsimpfung aus; (2.) sie gehen von gesundheitlichen Schäden enormen Ausmaßes aus, und zwar so enorm und in einer so hohen Anzahl, daß sie sich selbst schon bedroht fühlen.

7329

@ Hubi Stendahl:

„Wenn die nach der Trump-Wahl damit anfangen, sind alle Akten verschwunden und man hat nach bestem Wissen und Gewissen gehandelt.“ **

Das könnte sich auch bis zum Krieg „hochschaukeln“. Nach meinem Dafürhalten gibt es mindestens zwei globale Seiten privater Natur, die sich hier gegenseitig bekriegen und über die wir nur wenig gesicherte Information haben. Und ein lachender globaler Dritter ist natürlich auch dabei.

7330

Ja, dann haben wir ja eine „rosige“ Zukunft vor uns. Die Fremden hassen sie, die angeblich Oppositionellen aus dem eigenen Volk hassen sie auch (fein nach Frankfurter bzw. „68er“ Manier). Fazit für all diese Linken: In diesem Land wird sich nichts mehr ändern, weil wir - die Antifa und die Antiantifa - es so wollen. Der angebliche Widerstand gegen globale Maskerade und Antifa macht mit bei deren Unterdrückungssystem, verstärkt es sogar.

7331

@ Kathrina. ** **

Ich kann Sie trösten, Kathrina. Vom Volk ist sowieso noch nie „Revolution“ ausgegangen, auch nicht bei der „französischen“ oder „russischen“, denn alle „Revolutionen“ sind vom Geld bezahlt gewesen und haben immer nur zu noch mehr Geld und Macht auf der Seite derer geführt, die diese „Revolutionen“ bezahlt haben. Bei der angeblich „französischen Revolution“ hatten spätestens seit Robespierres Terror der Geldadel (die Hochfinanz, Finanzmafia) Frankreich so fest im Griff wie nie zuvor, und er hat es auch seitdem nicht mehr wieder losgelassen, auch nie wieder loslassen müssen, weil sich sowieso nichts dagegen regte in der „Grande Nation“. Und bei der angeblich „russischen Revolution“ war es auffallend ähnlich.

Der Geldadel wird selbst bald in große Probleme kommen. Aus seinen eigenen Reihen heraus. Trump könnte ein Vorbote dessen sein. Die Geschichte wird es zeigen.

7332

@ Herr Schütze. ** **

Man möchte sich aber manchmal auch ganz gerne bestätigt sehen. Sehen Sie das nicht so, Herr Schütze? Wenige Trolle kann ich noch ganz gut ignorieren, aber wenn die überall sind, in allen Medien, im alltäglichen Leben und überall auf der Welt, dann könnte ich auch an die Decke gehen.

7333

@ Erwin Lottermann:

„Von Helmut Oberth sollen folgende Worte stammen: »Das ethische Durchschnittsniveau einer Gesellschaftsschicht wird um so schlechter, je besser und einflußreicher sie gestellt wird. Dieser Umstand mag erklären, warum die Welt nicht schon seit 5000 Jahren ein Paradies ist.«“ **

Folgendes besonders zum zweiten Satz aus dem Zitat: Rousseau und nach ihm der Kommunismus haben ihre Gläubigen auf diese Weise gefischt. Selbst dann, wenn man vor den Zeitraum vor 5000 oder 6000 Jahren zurückgeht und von dort aus einen Neustart hinlegen will, wird dieser scheitern, und zwar immer wieder und immer wieder nach ersten Versuchen, mit denen es zu klappen scheint, sich aber später wieder herausstellt, daß es doch nicht klappt.

Die Menschen sind leider schon aus rein anthropologischen Gründen nicht dazu geeignet, ein Paradies zu erschaffen. Sie stehen sich dabei immer wieder selbst im Weg.

Schade.

7334

@ Vier:

„Oder schlimmer: war der Lockdown notwendig, um etwas ganz anderes zu verdecken, nämlich dass das ganze System am Ende und der Globalismus eine Sackgasse und nur noch über den Totalitarismus zu retten ist?“ **

Das ist mit sehr hoher Wahrscheinlichkeit so. Auch dürfen Sie nicht vergessen, daß diese „Ausnahmeländer“ nicht wirklich Ausnahmeländer sind: China hat angefangen mit dem Quatsch. Und in Weißrußland wird gerade eine Exempel statuiert. Warten Sie einmal ab, was da noch passiert! Ja, und Schweden. Und das waren sie auch schon. Es steckt immer ein Grund dahinter. Man sollte das Ganze auch ganzheitlich verstehen. Es betrifft den gesamten Globus. Wenn also irgendwo „Ausnahmeländer“ erscheinen - es sind ja, und zwar aus Absicht, immer nur ein paar -, dann folgt bald eine bestimmte Aktion in diesen „Ausnahmeländern“.

 

NACH OBEN 1285) Kathrina, 21.08.2020, 01:38; Herr Schütze, 21.08.2020, 02:19; Kathrina, 21.08.2020, 03:10 (7335-7337)

7335

@ Erwin Lottermann:

„Die »psychopathische Kaste« wird versuchen, die intellektuelle Schicht dieser Gesellschaft zu unterwandern, sie zu Mitläufern zu machen, was bereits global und umfangreich geschehen ist. Solch Mitläufer finden wir fatalerweise inzwischen in allen Gesellschaftsschichten , was wenig Hoffnung auf einen friedlichen Ausgang der Krise läßt, in der wir uns befinden.“ **

Schon die Vorläufer der heutigen Globalisten unterwanderten die intellektuelle Schicht im Abendland. Auch sie schon gaben sich als Liberalisten, Egalitaristen (Kommunisten), Fraternitaristen (Humanitaristen) und ähnliche Isten aus, wurden zumeist auch als solche verstanden, hatten aber immer nur, wenn es um die Intellektuellen ging, den Gedanken „Unterwanderung“ im Kopf. Im Abendland begann diese Unterwanderung noch vor der französischen „Revolution“, mit der sie in Frankreich sich fest etablieren konnte, und zwar trotz der Tatsache, das es auch Gegenwehr gab - bis etwa 1871 (als wieder eine „Revolution“ diese Gegenwehr beendete, diesmal für immer) -, die aber nicht mehr erfolgreich sein konnte. In Deutschland setzte die Unterwanderung zur selben Zeit ein wie im restlichen Westeuropa, konnte sich aber vor 1918 noch nicht durchsetzen, wurde also erst 1918 erfolgreich - und wieder mit einer „Revolution“. Man kann daher fast sicher sein, daß Unterwanderer auch schon die englische „Revolution“ von 1688 für sich nutzten, um sich in England zu behaupten. Immer dann, wenn von „Revolution“ gesprochen wurde und wird, war und ist Unterwanderung durch Geist und Geld die Ursache, wie auch Herr Schütze schon gesagt hat (**|**). Ein Beispiel aus jüngerer Zeit: Auch „Achtundsechzig“ ist ja besonders von den Intellektuellen als „Revolution“ bezeichnet worden, und daß diese Intellektuellen unterwandert, von der Frankfurter Schule beeinflußt waren und sind, ist bekannt.

Heute ist es nach meiner Einschätzung bereits so, daß die Jungintellektuellen eine der Unterwanderung ähnelnden Beeinflussung bereits seit ihrer Zeit im Kindergarten ausgesetzt sind. Das paßt auch symbolisch zu ihrem permanenten Gebrauch von Mobiltelefonen, Internet u.ä. sowie einer „Meinung“, die wie Kleidung von einer mittlerweile ebenfalls völlig unterwanderten Mode gelenkt wird.

7336

@ Kathrina:

„Söders Frau verkauft Mund-Nasen-Masken (MNM). Alles klar?“ ** **

Ja, Kathrina. Söders Geldgier ist der Grund für die strengen Vorschriften für das MN-Maskentragen in Bayern. Söder macht ein Riesengeschäft mit dem Verkauf von MN-Masken - allerdings nur dann, wenn MN-Masken auch getragen werden. Also wird Söder nicht so schnell aufhören mit seinem „Maskenball“.

7337

@ Herr Schütze:

„Nach meinem Dafürhalten gibt es mindestens zwei globale Seiten privater Natur, die sich hier gegenseitig bekriegen und über die wir nur wenig gesicherte Information haben. Und ein lachender globaler Dritter ist natürlich auch dabei.“ ** **

Und wer oder was sind diese drei? Ich nehme an, Sie meinen mit der einen Seite die, zu der Trump zu zählen ist, und mit der anderen Seite die Gegner Trumps. Ihr „lachender globaler Dritter“ kann doch dann nur die Hochfinanz sein. Ist das richtig, Herr Schütze?

Trump scheint gegen die Impfmafia zu sein, unternimmt aber auch selbst politische Versuche in Richtung Impfung. Die Gegner Trumps sind eindeutig auf der Seite von Soros und Gates (Linksrassismus / Antifa / Antihumanismus / Dysgenik). Aber ist diese Zweiseitigkeit in Wirklichkeit keine Zwistigkeit oder gar Feindschaft, sondern nur eine Inszenierung?

 

NACH OBEN 1286) Kathrina, 22.08.2020, 01:11; Herr Schütze, 22.08.2020, 01:13 (7338-7339)

7338

@ Zitrone. **

Wenn ich auf Ihre Fragen antworten darf:

„Warum betont Dr. Füllmich in fast allen Videos des Corona-Ausschusses, er sei gegen »Verschwörungstheorien«?“ **

„Trojanisches Pferd“ namens Reiner Füllmich. Sehen Sie dazu, was der geistig sehr bewanderte Herr Lottermann (**), der geistig sogar noch mehr bewanderte Herr Schütze (**|**) und ich (**|**) zu dem Thema „Unterwanderung“ geschrieben haben.

„Warum wurde dort noch nicht ein einziges Mal über ID 2020, Event 201 und »The Great Reset« des World Economic Forums gesprochen?“ **

Siehe: 1. Antwort.

„Wer soll eigentlich zur Rechenschaft gezogen werden, wenn Dr. Füllmich & Kollegen mit dieser Sammelklage durchkommen?“ **

Deutsche Steuerzahler.

„Wird die Immunität der Politiker aufgehoben und haften diese dann mit ihrem Privatvermögen?“ **

Nein. Selbstverständlich nicht.

„Oder wird wie immer der Steuerzahler die Zechen berappen und somit doppelt und dreifach belastet?“ **

Ja. Eher vierfach bis x-fach.

Danke für Ihre Fragen, die auch ein Licht auf die Naivität derer werfen, die diesem Linksanwalt Füllmich glauben. Man merkt ihm auch ganz deutlich seine Doppelzüngigkeit an. Er könnte auch einer der Trolle unter den hier Kommentierenden sein. Füllmich ist ein Unterwanderer. Vor allem aber ist entlarvend, was Sie in Ihren Fragen ja schon angedeutet haben, denn Füllmich heuchelt, läßt Teile des Themas aus, eliminiert sie, ersetzt andere Teile des Themas so, daß sein Text den Naiven nicht wie ein vom Lügenmainstream unterwanderter, sondern wie ein vom „Widerstand“ kommender „kritischer“ Text erscheint.

Das Thema ist ja den Nichtnaiven hier bekannt.

@ Zitrone:

„Fundstück:

»Das war so wichtig, dass ich es sofort herausholen wollte. Meine Recherchen in der NCBI-Datenbank für Nukleotidsequenzen haben zu einer verblüffenden Entdeckung geführt. Eine der WHO-Primersequenzen im PCR-Test für SARS-CoV-2 findet sich in der gesamten menschlichen DNS!

Die Sequenz »CTCCCTTTTGTTTGTGTTTTTGT« ist eine 18-stellige Primersequenz, die im Dokument des WHO-PCR-Testprotokolls für Coronaviren zu finden ist. Die Primersequenzen werden durch das PCR-Verfahren amplifiziert, um als »nachgewiesen« und als »positives« Testergebnis bezeichnet zu werden. Zufälligerweise findet sich genau diese 18-Zeichen-Sequenz wörtlich auch auf dem Homo-sapiens-Chromosom 8! Soweit ich das beurteilen kann, bedeutet dies, dass die WHO-Testkits bei allen Menschen ein positives Ergebnis finden sollten. Kann das jemand anders erklären?

Ich kann die Bedeutung dieses Ergebnisses wirklich nicht genug betonen. Zumindest sollte es einen nennenswerten Einfluß auf die Testergebnisse haben.

Homo-sapiens-Chromosom 8, GRCh38.p12 primäre Versammlung.
Sequenz-ID: NC_00000008.11 - Länge: 145138636.
Bereich 1: 63648346 bis 63648363 ist »CTCCCTTTGTTTGTGTTTTGT«.

Update: Nach einiger Anstrengung habe ich endlich einen Weg gefunden, um (über meine Screenshots hinaus) den Beweis zu erbringen, daß das menschliche Chromosom 8 genau dieselbe 18-Zeichen-Sequenz aufweist. Bitte versuchen Sie den untenstehenden Link. Die Sequenz wird unten auf der Seite angezeigt.« (**) (Übersetzt mit http://www.DeepL.com/Translator).“ **

Danke noch einmal.

Und jetzt?

7339

@ Herr Ludwig:

„Von einer geistigen Perspektive wird die Menschheit von höheren Wesen auf einen Entwicklungsweg gebracht, auf dem es nicht das Ziel ist, ein irdisches Paradies zu schaffen, sondern sich immer wieder in einem physischen Leib zu inkarnieren, um in der zunächst unbewussten, dann immer bewusster werdenden Auseinandersetzung mit bösen Mächten immer neue Kräfte auszubilden. Es ist unmöglich, aus der rein irdisch-materiellen Perspektive den Sinn des Erdenlebens und der Entwicklung der Menschheit zu verstehen.“ **

Wenn ich von „anthropologischen Gründen“ (**|**) spreche, meine ich nicht die „rein irdisch-materielle Perspektive“ allein, denn sonst hätte ich von „anthropologischen Ursachen“ (anorganisch) oder „anthropologischen Trieben“ (organisch) nur gesprochen, doch ich meine ja mit den „anthropologischen Gründen“ auch die „seelischen Motive“ und besonders die „geistigen Gründe“, und zwar - genau gesagt - diejenigen geistigen Gründe, die auf die anorganischen Ursachen, die organischen Triebe, die seelischen Motive und wieder auf die geistigen Gründe zurückwirken. Darum habe ich das Wort „Gründe“ (und eben nicht die Wörter „Ursachen“, „Triebe“, „Motive“) benutzt.

Die Ausbildung der über die Auseinandersetzung mit bösen Mächten sich erneuernden Kräfte ist ein sowohl religiöses (die Übung betreffendes) als auch ethisches Thema. Es muß dafür auch zuvor ein Verständnis eingeübt worden sein. Nur sehe ich dieses Verständnis mehr auf dem Gebiet der Empirie und Logik als auf dem Gebiet der Religion und Ethik.

@ Herr Ludwig:

„Rudolf Steiner bietet da als Eingeweihter in die höheren Welten Erkenntniswege und Perspektiven.“ **

Ich habe mit Thomas R. E. Lentze, der Steiners „Erkenntniswege und Perspektiven“, wie Sie sagen, sehr gut kennt, in seinem Reserveforum auch über Steiner gesprochen: Https://Reserveforum.de .

Wir haben uns nicht immer einigen können, aber immer gut vertragen.

@ Herr Ludwig:

„Man darf nur in seinem Erkenntniswillen nicht erlahmen und sich in der prüfenden Auseinandersetzung den Zugang durch mitgebrachte Vorurteile nicht selbst verbauen.“

Das ist richtig. In der Wissenschaft, von der ich eigentlich komme, nennt man diesen, für mich sehr hohen Wert „Objektivität“ (man soll die Subjektivität bei der Erkenntnis abgeschaltet lassen), im Alltag oft „Neutralität“ oder „Unvoreingenommenheit“, „Vorurteilslosigkeit“ genannt.


NACH OBEN 1287) Herr Schütze, 23.08.2020, 01:01; Kathrina, 23.08.2020, 01:18, 01:20; Herr Schütze, 23.08.2020, 01:41; Alf, 23.08.2020, 01:50; Kathrina, 23.08.2020, 02:08; Herr Schütze, 23.08.2020, 02:29, 04:09; Kathrina, 23.08.2020, 22:04; Alf, 23.08.2020, 22:47 (7340-7349)

7340

@ Vier:

„Mal sehen auf der Massen-Demo am 29.8.2020 in Berlin, wie viele das ganz anders betrachten.“ **

Vier! Vier Millionen werden kommen.

@ Vier:

„Durch den unsäglichen »Maulbindenerlaß« im »Corona-Schwindel« hat sie einen nächsten schweren Fehler begangen. Sie hat damit die Bedingungen für eine (dankbar gelenkte?) »Graswurzelbewegung« im »Querdenken« geschaffen, die am 29.8.2020 in Berlin auf eine Flutwelle ansteigen kann. Siehe hier: Zitat: »29.8.2020: Stürzen Querdenker die Regierung?« (**). **

Danke.

Panzer werden wohl nicht eingesetzt werden, aber die Regierung wird wohl zum Rücktritt gezwungen werden, wenn die Demonstranten wieder Millionen sein werden (siehe oben: „Vier Millionen werden kommen.“).

7341

@ Hubi Stendahl:

„@ Kathrina:

»Und jetzt?« ** **

Sie sind ein extrem aufmerksamer Mensch. Ihre Fragen zum Ausschuss beschäftigen mich seit der zweiten Sitzung. Und ich kommen zum gleichen Schluss.

Ohne die Demos in Berlin zu kritisieren, im Gegenteil, sie sollten in Anspruch genommen werden; aber auch Ballweg von Querdenken 0711 ruft in mir Warnzeichen auf. Er macht diese Demo zu einer bunten Hippie-Veranstaltung, wie man anhand des Equipments feststellen kann. Seine Vita gefällt mir auch nicht.

Wer bezahlt diesen immensen Aufwand für Logistik und Technik? Wer steht hinter diesem Programmierer, der nach eigenen Aussagen mit den großen internationalen Konzernen in Geschäftsverbindung stand oder steht mit einer Verfolgungssoftware, mit der er sogar das eigene Kind hat überwachen lassen. Hat er die Aufgabe die Massen zu binden? Immerhin hört man auf der Bühne nichts weiter als die Forderung zur Aufgabe der Maskenpflicht und Friede, Freude, Eierkuchen. Ich bin zunächst auch hier skeptisch. Mir fehlt das eindeutig formulierte Ziel!!!“ **

Danke.

Ja, so hat auch „Achtundsechzig“ funktioniert. Die „Revoluzzer“ und „Hippies“ fühlten sich schon wie „die höchsten Tiere“ aus Orwells Fabel „Farm der Tiere“ („Animal Farm“) dem Machthimmel sehr nahe. Und nach diesem Muster haben auch alle anderen sogenannten „Revolutionen“ funktioniert. „ Immer dann, wenn von „Revolution“ gesprochen wurde und wird, war und ist Unterwanderung durch Geist und Geld die Ursache, wie auch Herr Schütze schon gesagt hat (**|**). Ein Beispiel aus jüngerer Zeit: Auch „Achtundsechzig“ ist ja besonders von den Intellektuellen als „Revolution“ bezeichnet worden, und daß diese Intellektuellen unterwandert, von der Frankfurter Schule beeinflußt waren und sind, ist bekannt.“ (Kathrina, 21.08.2020. 01:38 [**|**]). Damit ist auch die von Ihnen gestellte Frage nach der Bezahlung und der Hinterleute, schlußfolgernd auch die Frage nach dem Massenbindungsauftrag und der Ziellosigkeit beantwortet.

7342

@ Zitrone:

„@ Kathrina. ** **

Oh, jetzt ist mir Hubi Stendahl mit seiner Antwort zuvorgekommen (**). Trotzdem stelle ich meinen vorbereiteten Text hier ein.

Zunächst einmal vielen Dank für Ihre Replik! Was den kontrollierten Widerstand angeht, sehe ich inzwischen auch eine Neuauflage der 68er Bewegung. Die Veranstalter von Querdenken und einige der Hauptpersonen, die auf deren Bühnen sprechen dürfen, faseln ganz im Sinne der Neuordner der Welt, ständig von einer »Menschheitsfamilie«, also im Sinne von »Wir alle sind eins«.

Will man aus diesem Grund unbedingt die paradiesbunte Antifa mit ins Boot holen, wie man hier, ab Min 12:30, hören kann?

Querdenken-Demo Hamburg 15.8.2020 – Bodo Schiffmann, Anselm Lenz, Michael Ballweg. Anselm Lenz ist unverkennbar ein begeisterter Anhänger der Antifa.

Ist Ihnen schon einmal aufgefallen, dass Leute wie Schiffmann, Ballweg, Lenz & Co., niemals andere politische Themen ansprechen, wie z.B. den Migrationspakt, tägliche Messerstechereien und Vergewaltigungen von Frauen aller Altersgruppen? Und genau wie Dr. Füllmich verschweigen sie ihren inzwischen millionenfachen Anhängern Themen wie: »The Great Reset«, Event 201, uvam.

Zu all diesen Leuten, die plötzlich wie Phönix aus der Asche auftauchten, gehört auch ein bekannter Photograph, der mit allen Größen der Querdenker irgendwie verbandelt scheint 1 (**).

Diogenes Lampe machte sich ebenfalls Gedanken über »Herrn Ballweg und die Neue Love-Parade« – Teil 1 (**).“ **

Lampen Diogenes hat es begriffen, und ich erachte es so wie er auch als wichtig, daß er es nicht unerwähnt läßt, „für die Richtigkeit“ seiner „ Angaben mal wieder keine Garantie“ zu übernehmen (**), denn das kann auch niemand von ihm erwarten. Mich würde einmal interessieren, woher er weiß, daß „Goldmann-Sachs und Black Rock ihre Macht bereits an Trump verloren haben“ (**) und ob wirklich „die ganze FED ... in der Hand des Präsidenten“ (**) ist . Ich meine, daß selbst bei diesen „Brocken“ immer noch alles möglich ist. Aber vielleicht ist diese Einschätzung nicht richtig. Wer weiß es schon?

Nur so nebenbei, Herr Lampe (falls Sie diesen Text lesen): Sie haben „Heiliges Römisches Reich deutscher Nation“ geschrieben, jedoch werden alle Anfangsbuchstaben groß geschrieben, weil „Heiliges Römisches Reich Deutscher Nation“ ein Name ist (Kürzel: HRRDN) - trotz der drei Adjektive in ihm -, ansonsten müßte man in diesem Namen die anderen beiden Adjektive auch klein schreiben: „heiliges römisches Reich deutscher Nation“. Fällt Ihnen etwas auf? Freuen würde ich mich dann aber trotzdem über folgende Schreibweisen: „europäische Union“, „vereinigte Staaten von Amerika“, „vereinigtes Königreich“, „heiliger Stuhl“ u.ä.; nur wäre das dann eher politisch als orthographisch gemeint. Niedliche Namen, nicht wahr? Wenn es nach dem politischen „Geschmack“ nur ginge, schriebe ich: „heiliges römisches Reich Deutscher Nation (hrRDN). Doch bin ich - Gott sei Dank - ein der rechten Form stets treu bleibender Mensch (der alten Rechtschreibregelung bleibe ich übrigens nur deshalb treu, weil die neue Rechtschreibregelung zum Verblödungsprogramm gehört).

Ich bedanke mich sehr herzlich für den Text. Manche Textstellen halte ich inhaltlich für ein wenig übertrieben, doch sind dafür die anderen Textstellen um so besser.

@ Zitrone:

„Anhang an @ Kathrina (**|**):

Meine Fragen sollten das Forum einfach nur zum Nachdenken anregen. Um sich nicht all zu sehr von den vielen Aktionen, die zur Zeit laufen, blenden zu lassen, sollte man alle Seiten abklopfen. MMn werden derzeit viele Menschen, in Bezug auf den 29. August, in eine Art Euphorie versetzt, die ihnen eine Lösung nur vorgaukelt.
Wirklich drängende Probleme, die außerhalb des Corona-Themas liegen, wie z. B. die illegale Migration, werden von den ganz oben stehenden Querdenker-Köpfen, nie thematisiert.“ **

Richtig! Genau das ist neben den Tatsachen Unterwanderung und Plötzlichkeit („Sponti“ läßt grüßen) eine sehr bedeutsame, wenn nicht sogar die bedeutendste Tatsache: die Sprache selbst, d.h. das Medium als das Vermittelnde (gleichgültig, ob in Wort oder Bild), die Rhetorik, die Agitation, das „Feilen“ am Ausdruck - denn damit wird die Masse außer Gefecht, in Angst, unter Terror gesetzt.

Ich habe hier oft von „Achtundsechzig“ gesprochen, will aber auch hinzufügen, daß ich 1956 geboren bin und deshalb 1968 weniger aktiv an „Achtundsechzig“ beteiligt war, es aber damals schon für sehr merkwürdig hielt, daß da junge Leute, Studenten zumeist, für etwas eintraten, das es doch „drüben“ schon längst gab, ich mich also fragte, was sich viele andere auch fragten: „Warum gehen die nicht nach drüben?“

„Wer zu spät (zum Konservativen) kommt, den bestraft das Leben (des Konservativen)“ - könnte man dazu eigentlich nur sagen, denn selbst dann, wenn damals alle „progressiv“ geworden wären (die meisten sind es ja ihrer eigenen falschen Einschätzung nach), wäre das Leben über sie hinweggegangen, weil das Leben nicht „progressiv“ voranschreitet, sondern in etwa so, wie ein Krebs sich fortbewegt (ein Schritt zurück, zwei Schritte vor). Das Wort „Progressivität“ mochte ich schon zur Zeit der „Achtundsechziger“ nicht, weil ich es mit „Verarschung“ in Verbindung brachte. Und spätestens seit 1990 kann man wissen und sagen: „Ja, Progressivität ist Verarschung“.

@ Zitrone:

„Warum?“ **

Auch das fing ja bereits mit den „Achtunsdechzigern“ an: „ich bin ja gegen Hitler, möchte aber sagen, daß ...“; „ich bin ja gegen Rechtsextreme, möchte aber sagen, daß ...“; „ich bin ja gegen Verschwörungstheorien, möchte aber sagen, daß ...“.

Politgeometrische Positionen

Übrigens bedeutet „konservativ sein“ nicht „rechts sein“, sondern auch als Konservativer kann man sich aussuchen, ob man „rechts“, „mittig“ oder „links“ sein will. Die Gegner des Konservativen - die „Progressiven“ (Antikonservativen) haben auf suggestive Weise gesagt, daß man nur als „Progressiver“ eine solche Wahl hätte. Warum? Sie wollen das Konservative (die Verteidigung der Tradition, der Vergangenheit, der eigenen Herkunft, also der eigenen Geschichte) verbieten, indem sie es mit dem Attribut „rechts“ verbinden, also falsch einordnen, um es wirksamer bekämpfen zu können.

Die das Querdenken Unterwandernden lenken ab von den Themen der Demonstranten, indem sie deren Themen, hinter denen ja Interessen stehen, ignorieren, eliminieren, permutieren (erst eliminieren, dann umstellen), ganz andere Bezüge herstellen, so daß am Ende wieder das Muster zu erkennen ist, das auch schon damals bei den „Achtundsechzigern“ zu erkennen war. Dabei werden auch Vergleiche angesprochen, die zuletzt nur noch als Gleichungen dastehen, z.B.: „Coronagegner = Verschwörungstheoretiker = Rechtsextreme“ (zumindest aber „Rechte“, wobei wieder eine Gleichung folgt - „Rechte = Konservative = Verschwörungstheoretiker“ -, mit der die Verbindung zur ersten Gleichung [wieder] gegeben ist und „Coronagegner“ folglich doch „Verschwörungstheoretiker“ und „Rechtsextreme“ sind).

Die Antwort auf Ihre Frage ähnelt somit der, die ich Ihnen am 22.08.2020 um 01:11 Uhr gab (**|**).

7343

@ Kathrina (oder heißen Sie nicht Kathrina, sondern Katharina?):

„@ Herr Schütze:

»Nach meinem Dafürhalten gibt es mindestens zwei globale Seiten privater Natur, die sich hier gegenseitig bekriegen und über die wir nur wenig gesicherte Information haben. Und ein lachender globaler Dritter ist natürlich auch dabei.« ** **

Und wer oder was sind diese drei? Ich nehme an, Sie meinen mit der einen Seite die, zu der Trump zu zählen ist, und mit der anderen Seite die Gegner Trumps. Ihr „lachender globaler Dritter“ kann doch dann nur die Hochfinanz sein. Ist das richtig, Herr Schütze?

Trump scheint gegen die Impfmafia zu sein, unternimmt aber auch selbst politische Versuche in Richtung Impfung. Die Gegner Trumps sind eindeutig auf der Seite von Soros und Gates (Linksrassismus / Antifa / Antihumanismus / Dysgenik). Aber ist diese Zweiseitigkeit in Wirklichkeit keine Zwistigkeit oder gar Feindschaft, sondern nur eine Inszenierung?“ ** **

Vielleicht ist es so, vielleicht ist es aber auch nicht so. Ich weiß es auch nicht genau. Hier kann man eigentlich nur spekulieren, weil ja nichts nach außen dringt. Esoterik, Geheimhaltung bis hin zur Verschwörung. Wie soll man darüber etwas ganz genau wissen können?

7344

@ Waltomax:

„Das verfassungswidrige Verhalten von Merkel und Söder wirft die Frage auf, ob das Deutsche Volk nunmehr ein Recht zum Widerstand hat.

Auch heute müßte es doch verantwortungsvolle Offiziere der Bundeswehr geben, um Verbrecher von der Spitze des Staates zu entfernen.

In der Deutschen Geschichte haben sich ja schon einmal hohe Militärs für ihr Gewissen und gegen ihre Pficht zum Gehorsam entschieden.

Ist denn da niemand, sich mit Trump und Putin abzusprechen, um Merkel vom Kanzleramt in den Hausarrest zu verfrachten, bis ihr der Prozess gemacht werden kann? Wegen mehrfachen Hochverrates!

Das gleiche gilt für Söder und Konsorten. Absetzen, verhaften und vor Gericht stellen.

Das kann nur die Bundeswehr.“ **

Ich weiß nicht, wie sehr Trump und Putin wirklich auch „an einem gemeinsamen Strang ziehen“. Ich verweise diebezüglich auf das, was Herr Schütze (**|**) und Frau Kathrina (**|**) bereits gesagt haben, und das „Zitat: »29.8.2020: Stürzen Querdenker die Regierung?« (**)“ von Vier (**). Rußland ist seit einigen Jahren wieder eine Großmacht und geostrategisch für Deutschland sehr bedeutsam. Deshalb sollte Deutschland, das ja auch eine Großmacht ist, sich mit ihm gut verstehen. Die einzige Weltmacht, die es gibt, sind die Vereinigten Staaten von Amerika. Sie mag bald in dieser Position von China verdrängt oder zumindest eingeholt werden, so daß wir es dann mit zwei Weltmächten tu tun haben würden und wohl auch werden. Das, was hier passiert, muß abgesprochen werden, weil es sowohl von der westlichen Seite als auch von der östlichen Seite abgesichert sein muß. Also dürfen die Interessen der Vereinigten Staaten auf der einen und China auf der anderen Seite nicht dagegen sprechen. Das müßte aber zu regeln sein. So gesehen: „Bundeswehr, marsch, marsch!“.

Verhaftung, Gericht, Gefängnis.

Mehr kann ich dazu auch nicht sagen.

Wie ist das denn in den anderen Ländern? Es ist ja trotz oder wegen dieser Maulkorb-Diktatur noch nirgendwo eine Regierung gestürzt worden.

„Wie lange möchte uns das Denken wohl noch erlaubt bleiben.“

7345

@ Erwin Lottermann:

„Sind Sie Blutspender(in) oder haben Sie in den vergangenen 10-12 Jahren Blutuntersuchungen (die über KK abgerechnet wurden) durchführen lassen, dann können Sie davon ausgehen, dass Ihr Genom bereits »abgespeichert« wurde.“ **

Sind nicht bereits ALLE gespeichert?

7346

@ Vavildi:

„5.) Die Pläne werden ausführlich hier beschrieben (**).“ **

Was sagen Sie denn zu der dort erwähnten Deagel-Liste (unter Punkt 9) sowie zu dem Inhalt der Seite, auf die dort verwiesen wird und den folgenden Titel trägt: „Bis 2025: Deutschlands Bevölkerung soll um 50 Millionen Menschen reduziert werden“ (**)? (Von der dort angebenen Zahl der verbleibenden Bevölkerung her gesehen sind es sogar 55-60 Millionen Menschen!).

Glaubt man diesen Zahlen, dann scheint es so zu sein, daß ausgerechnet diejenigen Völker am meisten Tote zu beklagen haben werden, die denjenigen, die Schuld an diesem Massensterben haben, am meisten bei der Erlangung der Weltherrschaft geholfen haben.

7347

@ Kathrina:

„@ Herr Schütze. ** **

Man möchte sich aber manchmal auch ganz gerne bestätigt sehen. Sehen Sie das nicht so, Herr Schütze? Wenige Trolle kann ich noch ganz gut ignorieren, aber wenn die überall sind, in allen Medien, im alltäglichen Leben und überall auf der Welt, dann könnte ich manchmal auch an die Decke gehen.“ ** **

Das sehe ich schon genauso wie Sie, Kathrina, möchte jedoch auch auf das Vertrauen auf Gott hinweisen.

„Trojanische Pferde“, die Sie „Trolle“ genannt haben, gab es immer schon in der Geschichte, also gibt es sie auch heute und wird es sie auch in Zukunft geben. Die Zukunft ist ja auch Geschichte, nur ist sie noch nicht oder nur auf eine Weise, die der Wettervorhersage ähnelt, erzählt worden.

Ich gehe von einer Gelegenheit für uns aus, nach der es gegenwärtig zwar nicht aussieht, die sich aber bald zeigen wird, weil vom Plan her nicht vorgesehene Fehler auftreten werden.

7348

@ Vier:

„Zitat:
»Da hilft kein Zorn. Da hilft kein Spott.
Da hilft kein Weinen, hilft kein Beten.
Die Nachricht stimmt! Der liebe Gott
ist aus der Kirche ausgetreten.«
(Erich Kästner, aus: »Neues vom Tage«)

Ob die das schon wissen, die Kuttenträger?“ **

Meinen Sie die Jungs aus dem Motorradclub? Bei den kirchlichen Kuttenträgern müßten wir unterscheiden zwischen Ober-, Mittel- und Unterschicht. Die Oberschicht hat es immer schon gewußt, die Mittelschicht wahrscheinlich auch, aber die Unterschicht wohl eher nicht, zumindest nicht alle ihre Angehörigen.

Um dem Thema hier noch näherzukommen, müßte in dem Gedicht das Wort „Gott“ durch das Wort „Herrscher“ und das Wort „Kirche“ durch das Wort „Menschheit“ ersetzen.

7349

Thema: Wahlen (ob in Bayern oder im Rest Deutschlands).

Ich möchte einmal aufräumen mit dem von nur wenigen, aber ganz bestimmten Kommentierenden (Kathrina nennt sie „Trolle“), entweder aus Unwissenheit oder mit böser Absicht ins Gespräch gebrachten Vorurteil, das Volk habe Schuld an der Misere, die uns ereilt hat. Dieses Vorurteil ist falsch. Wieder zeigt uns die Fassade etwas ganz anderes als die Wirklichkeit.

Schon die Voraussetzung für dieses Vorurteil ist falsch. Es werden hier Volk und Wahlvolk in einen Topf geworfen, dabei werden wir weiter unten sehen, daß z.B. das Wahlvolk der Blockparteien weniger als die Hälfte ausmacht. ** **

Dann wird - wieder entweder aus Dummheit oder mit einer bösen Absicht - behauptet, im Nach-1945-Deutschland gäbe es für das Volk die Möglichkeit, Personen in die politischen Ämter zu wählen. Auch diese Aussage ist falsch. Immerhin konnte das Deutsche Volk während der Weimarer Republik den Reichspräsidenten wählen. Doch in der Nach-1945-Republik, der Bonner und Berliner Republik, geht das nicht. Seit 1949, als die Bundesrepublik Deutschland gegründet wurde, darf das Deutsche Volk den Bundespräsidenten NICHT wählen, obwohl dieser nur repräsentative Aufgaben (von den frühen Bundespräsidenten auch als Pflichten verstanden) hat. In der Bundesrepublik Deutschland darf das Volk nur Parteien wählen.

Folgend möchte ich eine wahlpolitische „Bilanz“ vorstellen, wie man sie der Form nach auch aus der wirtschaftlichen Buchführung kennt. Berücksichtigt habe ich auf der Aktivseite („AKTIVA“) die Wähler der Blockparteien und der AfD (die noch keine Blockpartei ist, aber dabei ist, eine zu werden) und auf der Passivseite („PASSIVA“) diejenigen, die nicht wählen, nicht wählen dürfen und solche Parteien wählen, die wegen der 5%-Hürde nicht an der aktiven Politik beteiligt sein können (dieser Tatbestand ist übrigens genauso verfassungswidrig wie viele andere Tatsachen, die die Wahl betreffen), sondern sie passiv erleiden müssen.

Die Zahlen beziehen sich auf die Bundestagswahl 2017:

Bundestagswahl 2017
AKTIVA PASSIVA
CDU/CSU (Blockpartei) 25,1  

Nichtwahlberechtigte als „Partei“

27,4
SPD (Blockpartei) 15,6   Nichtwähler als „Partei“ 23,8
AfD 9,6   Unter-der-5%-Hürde-Parteien 3,9
FDP (Blockpartei) 8,2   Buchhalternase
Linke (Blockpartei) 7,0  
Grüne (Blockpartei) 6,8    
Zwischensumme 72,3   Zwischensumme 55,1
Buchhalternase   Saldo (gegenüber der Aktivseite) 17,2
Summe 72,3   Summe 72,3

Hätte ich eine „Bilanz“ erstellt, die auf der Aktivseite nur die Blockparteien berücksichtigt hätte, dann wäre die Passivseite der Aktivseite überlegen. Aktiva: 62,7; Passiva: 64,7. Also 2 mehr auf der Passivseite! Das heißt: Die Blockparteien werden von nur 49,2 Prozent des Volkes gewählt. Wir sind ein Volk, bestehen also aus 100% und nicht aus „49,2 Prozent“ (Blockparteienwähler).

Außerdem müssen für die falsche These, das Volk (die Trolle meinen damit fälschlicherweise die eben erwähnten 49,2 Prozent) wähle aus „Dummheit“ - eine dumme Behauptung (!) - zwei weitere Aspekte berücksichtigt werden, nämlich zum einen der Profit, auf den schon K. W. (**), zum anderen die Angst, auf die schon Kathrina (**|**) hingewiesen hat.

Profit.  –  Drei Viertel der Wähler der Blockparteien profitieren von ihrer Wahl - sie wählen also nicht aus Dummheit, sondern aus einem Kalkül und damit aus einer Intelligenz heraus. Auf das Volk bezogen heißt das, daß 36,9 Prozent des Volkes aus einer aus Profitinteresse erfolgten Berechnung heraus wählen.

Angst.  –  Von den die Blockparteien wählenden 49,2 Prozent des Volkes bleiben nur noch 12,3 Prozent des Volkes übrig, die entweder aus Angst oder aus Dummheit die Blockparteien wählen. Aber es geht ja noch weiter:

Wie hoch die Prozentzahl derjenigen ist, die aus Angst wählen, weiß ich nicht (Kathrina würde wahrscheinlich sagen: „relativ hoch“). Ich veranschlage „nur“ 10 Prozent.

Dummheit?  –  Aus Dummheit können nach dieser Berechnung höchstens 2,3 Prozent des Volkes die Blockparteien wählen, wobei hinzugefügt werden muß, daß diese Prozentzahl sehr wahrscheinlich sogar nach unten berichtigt werden muß, so daß das Ergebnis für die aus Dummheit die Blockparteien Wählenden wohl noch nicht einmal 0,1 Prozent des Volkes ist.

Es kommt bei dem Thema hier auch gar nicht auf ein Promille mehr oder weniger, auch nicht auf ein Prozent mehr oder weniger, ja noch nicht einmal auf zehn Prozent mehr oder weniger an, sondern nur darauf, daß das eingangs erwähnte, aus Dummheit oder Böswilligkeit heraus erwähnte, trollige Vorurteil falsch ist.

@ Kathrina:

„Offiziell (ob auch tatsächlich, ist sehr fragwürdig) wählten 2017, von der Wahlbeteiligung von 76,2 Prozent ausgehend (also gleich 100 Prozent setzend, was nur legitim ist): 25,1 Prozent die CDU/CSU, 23,8 Prozent gar nicht (vgl. Wahlbeteiligung: 76,2 %), 15,6 Prozent die SPD, 9,6 Prozent die AfD, 8,2 Prozent die FDP, 7,0 Prozent die Linke, 6,8 Prozent die »Grünen« und 3,9 Prozent sonstige Parteien. Die Regierungskoalition besteht also so gesehen aus einer Minderheit (40,7 Prozent CDU/CSU/SPD) und schon allein deswegen verfassungswidrig, nennt sich aber verlogenerweise auch noch „Große Koalition“. Unter diesen Bedingungen könnten mit derselben Berechtigung auch die Nichtwähler, die AFD und die Wähler der sonstigen Parteien eine Koalition eingehen und regieren (37,3 Prozent), notfalls auch mit der FDP, dann hätten sie zusammen sogar 45,5 Prozent und damit 4,8 Prozent mehr als die angebliche »Große Koalition«.

Dazu kommt, daß diese Wahlergebnisse höchstwahrscheinlich eine Lüge sind, daß also stets zugunsten der CDU/CSU/SPD/FDP/„Grünen“/Linken-Blockpartei(en) gefälscht wird.

Viele haben Angst und wählen aus Gewohnheit wie zuvor. Das ist nicht richtig, auch nicht gut, aber ganz schwer zu ändern, weil sie Angst haben, völlig verunsichert sind. Angst ist etwas Irrationales, und wenn die die Entscheidung bei einer Wahl bestimmt, dann wird es sehr schwierig für die Nichtmainstreamler, die Verängstigten und Verunsicherten zu überzeugen. Dies alles ist aber selbst Teil des Plans. Die Angst und die Verunsicherung sind in der Kalkulation der Hintertanen enthalten und vergleichbar mit Chaos, das auch darin enthalten, ja sogar eines der bedeutendsten Etappenziele ist.

So funktionieren Wahlbetrug und Wählerbetrug im heutigen Westen, der sich früher mokierte über Wahl- und Wählerbetrug im kommunistischen Osten. Mittlerweile ist der Westen dabei, den damals kommunistischen Osten zu überholen.“ ** **

Recht haben Sie, Kathrina. Danke.

 

NACH OBEN 1288) Kathrina, 24.08.2020, 01:00; Alf, 24.08.2020, 04:28, 04:48; Herr Schütze, 24.08.2020, 19:20, 23:59 (7350-7354)

7350

@ Alf. ** **

Danke für das erneute Thematisieren der Wahlen, des Wahl- und Wählerbetrugs. Auch bei diesem Thema fällt auf, wie erfolgreich die falschen Aussagen und deren stumpfe Wiederholung durch die Medien sind. Sie bauen Lügengebäude, schmücken deren Fassaden, weil niemand die Wirklichkeit erkennen und die Wahrheit wissen soll.

@ Till Außenspiegel:

„Meine Vermutung ist, daß die »ewige Pandemie« den permanenten Maskenzwang rechtfertigen soll. Durch die mangelnde Sauerstoffversorgung des Gehirns wegen der Maske leidet das Denkvermögen, die Menschen werden dadurch leichter erreichbar für Suggestionen, akzeptieren eher eine Impfung, die ihr Genom verändert und sterben später an unheilbaren Impfschäden. Solch ein Impfschaden könnte auch die Unfähigkeit zur Fortpflanzung sein!

Auf diese Weise kann es schließlich möglich gemacht werden, diesen Planeten von Milliarden Menschen zu »befreien« ohne auch nur einen einzigen Schuß abzugeben.

Erscheint zwar auch mir äußerst dystopisch und dennoch ziemlich plausibel.“ **

Und das ist auch plausibel. Stellen Sie sich einmal vor, Sie wären gerade erwachsen geworden und zuvor während ihrer gesamten Kindheit und gesamten Jugend mit einer Mund-und-Nasen-Maske herumgelaufen, hätten also ihre eigene ausgeatmete, sehr kohlendioxidreiche, dafür aber um so sauerstoffärmere Luft eingeatmet. Wir wissen, daß sehr mächtige Menschen, die kaum jemand kennt, die Bevölkerung reduzieren wollen und sie auch schon in Teilen der Welt (nicht zuletzt im Westen - Stichwort: Abtreibungspolitk) reduziert haben. Auch wissen wir, daß sie die Weltbevölkerung impfen wollen und nicht wenige Menschen bereits kaputtgeimpft haben, daß sie die Bevölkerungen in Kriege getrieben haben und weiterhin treiben werden, daß sie die Wirtschaft und unseren Planeten zerstören, weil sie geldgierig, geizig und rücksichtslos gegenüber anderen Menschen, anderen Lebewesen, der ganzen Schöpfung sind.

Habe ich etwas vergessen?

Bringen Sie jetzt das alles zusammen, dann wird sofort klar, daß die Globalisten gar keine andere Wahl haben als die, die auf die globale Zerstörung, das „Große Chaos“, wie Volkmar Weiss jetzt sagen würde, schnurstracks zuläuft.

Wunderte Sie das Ergebnis nun? Wohl kaum. Oder?

7351

@ Hubi Stendahl.

„Hippie-Veranstaltung“, „Bezahlung“, „Massenbehinderung“, „Friede, Freude, Eierkuchen“, „fehlendes Ziel“. **

@ Zitrone.

„Kontrollierter Widerstand“, „Neuauflage der 68er Bewegung“, „Faselnganz im Sinne der Neuordner der Welt“, „Menschheitsfamilie“, „paradiesbunte Antifa mit ins Boot holen“, „Anselm Lenz ist unverkennbar ein begeisterter Anhänger der Antifa“, „niemals andere politische Themen ansprechen, wie z.B. den Migrationspakt, tägliche Messerstechereien und Vergewaltigungen von Frauen aller Altersgruppen“, „verschweigen von Themen wie: »The Great Reset«, Event201 ...“, „plötzlich wie Phönix aus der Asche auftauchen“, „neue »Love Parade«“, „illegale Migration“. ** **

Sehr gut beobachtet. Was bleibt: Skepsis, Beobachtung, Urteilsbildung, bei einer Entscheidung dafür: Beteiligung, Zusammenhalt, Feinderkennung.

Ich habe für manche Redner bei den Demonstrationen Verständnis, weil ich auch vermute, daß sie Angst haben. Mich erinnert diese Situation auch an die Demonstrationen der DDR-Deutschen im Herbst 1989 oder an die der Chinesen auf dem „Platz des Himmlischen Friedens“, die die „Internationale“ sangen, um zu zeigen, daß sie nicht das System stürzen, sondern nur ein wenig Freiheit von ihnen bekommen wollten. So etwas mündet fast immer in Gewalt, oft in Krieg.

Es gibt aber bei den Demonstrationen auch welche unter den Rednern, bei denen man sogleich, wenn man sie sprechen hört, weiß: das sind Unterwanderer, „Trojapferde“, „Lokomotiven“, die die immer länger werdenden „Züge“ (die immer mehr zunehmenden Massen) über andere Gleise und darüber in andere Richtungen als die, die von den Demonstranten vorgesehen waren, lenken sollen.

Wieviel Geld Soros und seine Kumpels in diesen widerlichen linksrassistischen Pöbel namens „Antifa“, der jede Demonstration auf extreme Weise stört, gesteckt haben, ist immer deutlicher zu sehen.

7352

@ Kosmokrat:

„Das liegt meiner Einschätzung nach an mangelnden Tugenden. Tugend kommt von taugen. Wer keine Tugenden hat, taugt nichts. Wer sich dagegen Tugenden aneignet und sie pflegt, erwirbt sich in Bezug auf den sittlichen Verfall der Massen eine geistige Immunität.“ **

Diese jungen Leute tun mir sehr leid. Sie kennen doch nur diese eine Erziehung: linke Zucht. Und „links“ bedeutet „falsch herum“, eben: falsch!

7353

@ Walter:

„Zu Hartwig an @ Kathrina, 19.08.20, 09:20:

Die Behauptung des Foristen Hartwig das Deutschland die EU zerstöre und die Entwicklung anderer Staaten behindere wie ein Parasit - ist der größte Unsinn den dieser hier kommentiert hat.
Die Eu wird durch den aufgezwungenen Euro zerstört. Wenn man Staaten mit so unterschiedlicher Wirtschaftskraft in eine gemeinsame Währung presst, dann schwächt man diese Staaten noch mehr und zerstört damit den Euro und die EU.

Durch die von der EZB von ehemaligen Goldman-Sachs-Bänkern verordnete Geldschwemme in die wirtschftsschwachen Länder und vor allem in die südeuropäischen Staaten und den auch verordneten Nullzins, werden nicht nur diese Staaten noch mehr verschuldet sondern auch Deutschland als größter Geldgeber in der EU. Damit wird auch der Lebensstandard in Deutschland jetzt und in Zukunft negativ beeinflusst. Man könnte allenfalls die deutschen Politiker, welche mithelfen Deutschland ins finanzielle Chaos zu stürzen dafür verurteilen.

Durch die sich jetzt immer mehr anbahnende Schuldenvergemeinschaftung wird Deutschland als Zahlmeister der EU finanziell zerstört, aber dies kann der hochwissenschaftlich arbeitende Forist Hartwig als den er sich selbst bezeichnet hat wohl nicht verstehen. Das es mit seinen wissenschaftlichen Kenntnissen nicht weit her ist habe ich ihm schon mehrfach bewiesen.
Deshalb sollte er anderen Foristen nicht absprechen, was er selbst nicht besitzt.

Dies kann er auch nicht mit seinen hochtrabenden geistig schwüllstigen Aussagen unter Einbeziehung des großen Philosophen »Karl Popper« kaschieren.
Das die Vernunft fehlerbehaftet ist. um dies zu verstehen brauchte es einen Philosophen wie Popper.
Das die biblischen Religionen fehlerbehaftet sind, dazu braucht man nur einen klaren Menschenverstand. Diesen hatte auch Popper, mal abgesehen von seiner hohen geistigen Bildung gehabt, da er als Kind assimilierter Juden mit Religion nicht viel am Hut hatte und stark von dem Philosophen Immanuel Kant beeinflusst war.

Einem Foristen Hartwig, welcher hier öfter als Religionsfanatiker auftritt, muss sich doch selbst die Frage stellen, ob er diesen klaren Menschenverstand auch vorzuweisen hat.
Von einer freien und höflichen Diskussionskultur wie er sie in These 5 fordert - kann bei seinen mit manchmal bösartigen und beleidigenden Äußerungen gespickten Kommentaren nicht die Rede sein.“ **

„@ Adorjan Kovacs an Kathrina 19.08.20, 10:42:

Auch der Aussage von Prof. Kovacs dem Autor dieses Artikels das Deutschland am meisten profitiert hat kann ich nicht zustimmen.
Deutschland hat nach dem 2. Weltkrieg sich zum wirtschaftlich stärksten Staat in Europa entwickelt und ist dies auch nach der Einführung des Euro geblieben.
Dies hat nichts mit dem Euro zu tun was uns manche Politiker immer weismachen wollen, sondern ist einfach seiner starke Wirtschaftskraft geschuldet, welche unabhängig vom Euro vorhanden ist. Allerdings ist der Lebensstandard der Bevölkerung zurückgegangen. So viele Tafeln und Suppenküchen die es heute in diesem Land gibt, gab es vor der Einführung des Euro nicht. Die Löhne wurden durch den Euro halbiert und auch die Preise, welche aber nach gewisser Zeit zum Teil wieder auf D-Mark Niveau angestiegen sind. Und wenn man das Median-Vermögen in Westeuropa betrachtet, liegt Deutschland mit an letzter Stelle bei den westlichen Euro-Staaten. Dies ist eine Tatsache und beweist eindeutig, dass die Bevölkerung vom Euro nicht profitiert hat, im Gegenteil.

Wer vermutlich profitiert hat sind die großen Aktienkonzerne, welche fast alle mit internationaler Beteiligung agieren. Dies ist dem Globalismus zu verdanken der heute die Märkte beherrscht.
Dies will Trump ja in den USA verändern, weswegen er ja von einem Teil der westlichen politischen Eliten beschimpft wird. Da weiß man auch für wen diese Politik machen.

Großkonzerne verlagern ihre Produktionen ins billiger produzierende Ausland, wo sie weniger Lohnkosten und Steuern zahlen müssen und erhöhen damit ihren Profit, was aber ihrem Land nicht zugute kommt. Das dadurch die Arbeitslosenzahl steigt und der Lebensstandard sinkt interessiert diese nicht. Die Gewinner sind dabei die großen Aktienunternehmen. Man muss aber auch sehen, dass Unternehmen die diesem Trend nicht folgen irgendwann nicht mehr konkurrenzfähig sind. DAS PROBLEM IST DIE UNGEBREMSTE GLOBALISIERUNG.

In diesem Zusammenhang kann man auch das Argument des von mir hoch geschätzten ungarischen Ministerpräsidenten Victor Orban beantworten, warum Arbeiter in Deutschland mehr verdienen als Arbeiter in deutschen Fabriken in Ungarn.
Ein Grund sind die höheren Lebenshaltungskosten in Deutschland und ein zweiter Grund das die Unternehmen einen höheren Profit machen wollen. Dies ist aber kein Gewinn für das deutsche Volk, welches dadurch Arbeitsplätze verliert und damit die schon vorhandene Arbeitslosenzahl noch erhöht. Kein Unternehmer investiert im Ausland wenn es sich für ihn nicht finanziell lohnen würde. Aber die Politiker verkaufen uns dies, dass damit doch die Wirtschaft im anderen Land gestärkt würde, was ja auch zu einem Teil stimmt. Auch der ehemalige Ostteil von Deutschland ist heute zum großen Teil eine verlängerte Werkbank für die Großkonzerne und die Arbeiter verdienen auch weniger als im westlichen Teil der Republik. Aber so funktioniert eben das globalisierte kapitalistische Wirtschaftssystem. Der Traum von der sozialen Marktwirtschaft ist schon lange vorbei.

Es gibt aber auch gegenteilige Beispiele. so werben z.B. ungarische Zahnkliniken in Deutschland für sehr preisgünstigere Zahnbehandlungen gegenüber Deutschland und viele Rentner mit kleinen Renten verbringen ihren Lebensabend auch mittlerweile in ungarischen Altersheimen.
Jedes Land versucht mit seinen Möglichkeiten in diesem konkurrierenten System zu bestehen.
Es gibt aber auch Beispiele von kleinen Euro - Ländern wie Österreich, Niederlande, Finnland und Dänemark, welche einen guten Lebensstandard haben. An diesen könnten sich die kleinen osteuropäischen Länder orientieren.

Der jetzigen EU traue ich jedenfalls nicht zu, dass sie diese Probleme vernünftig zu lösen im Stande ist.“ **

Selbstverständlich stimmt das, was Sie sagen - hinzuzufügen ist jedoch, daß Deutschland schon seit den 1880er Jahren die mit weitem Abstand stärkste Wirtschaftsmacht ist. Daß man überhaupt über solche Selbstverständlichkeiten reden muß, hat man solchen Leuten zu verdanken, die auch im Internet als Trolle, „Trojapferde“, eben als Unterwanderer alles im Sinne der gegen das Deutsche Volk gerichteten Lügenpolitik und Lügenmedien verbreiten und damit Hetze betreiben. Deshalb wird auch an Schulen und Universitäten keine Geschichte mehr gelehrt und gelernt, sondern nur noch Religion, Pseudoreligion, die den Sinn hat, unsere Geschichte vergessen zu machen, z.B. durch Verteufelung. Das sind Methoden der Teufelsanbeter, die den Teufelsaustreiber vortäuschen. Diese Leute, die das tun, werden immer mehr.

Das schützt aber die - wie Sie, Walter, und ich z.B. -, die das nicht mitmachen wollen, nicht davor, zu Opfern dieser Leute zu werden. Wo werden wir denn verteidigt? Nirgendwo! Der UNO zufolge sind wir und die Japaner sogar immer noch der „Feind der Welt“! Und das, obwohl wir und die Japaner am meisten Beiträge an die UNO zahlen. Was ist das für eine Welt?

Da ich aus Westdeutschland komme und den „Kalten Krieg“ noch erlebt habe, kann ich zu diesem Mist hier nur sagen, daß er auf den Lügen aufgebaut ist, auf denen auch schon die „Bewegung“ der „Achtundsechziger“ aufgebaut war.

Die Visegrad-Staaten fahren einen Nationalsozialismus, den wir Deutschen sogar auch noch bezahlen. Das ist Zwang, nicht Dummheit. Ein Kind in der Schule darf auch nicht den Lehrplan erstellen, nach dem es unterrichtet werden will, kann aber trotzdem sehr gute Noten haben. Dummheit ist also immer relativ. Wer sich etwas verspricht davon, daß andere für dieses Versprechen bezahlen, der ist nicht solidarisch, sondern egoistisch, und bezüglich Länder oder Staaten oder Nationen ist das Nationalismus, und wenn er auch noch Sozialismus enthält, dann Nationalsozialismus.

Wir werden ja sehen, ob diese Länder oder Staaten oder Nationen in naher Zukunft, wenn viele Deutsche wieder einmal sich vertreiben lassen, flüchten werden müssen (diesmal in die andere Richtung), ob diese Visegrad-Staaten bereit sein werden, die Deutschen zumindest in der Ex-Heimat der Ostdeutschen und der Sudetendeutschen sowie der Nordost- und Südosteuropadeutschen, die jetzt noch alle im Exil leben, aufzunehmen. Nicht wenige dieser Vertriebenen leben ja noch. Da ich die Mentalität der Ost- und Ostmitteleuropäer kenne, weiß ich, daß sie freiwillig keine Aufnahmebereitschaft zeigen werden.

Sozialamt der Welt
Warum darf Deutschland nie auf der Sonnenseite stehen? Weil es immer nur ausgebeutet wird und ausgebeutet werden soll. Warum? Weil es zu erfolgreich war und ist. Wer zu intelligent, zu fleißig, zu wohlhabend und dann auch noch zu „gutmenschlich“ ist, der wird dafür bestraft.

Unsere Argumentation hat nichts mit Ablehnung nationaler Interessen zu tun, aber wenn klar ist, daß Staaten Europa schaden, wenn sie mit Hilfe der EU, von der mittlerweile mehr als 90% aller Gesetze kommen, andere europäische, vornehmlich westliche bzw. westmitteleuropäische Länder, allen voran und mit weitem Abstand Deutschland natürlich ständig zur Kasse bitten, hat das nichts mit europäischer Solidarität zu tun. Es hat aber sehr viel mit dem Gegenteil von europäischer Solidarität zu tun!

EU ?  NEIN !
Außerdem wurde die EU aus genau diesem Grund gegründet: Ausplünderung Deutschlands - „Versailles ohne Krieg“ (François Mitterrand), zu der der Euro den bislang größten Beitrag geleistet hat, von den Rettungsschirmen für die angeblich „so armen“ Länder im Süden Europas, die bis dahin - und auch wieder auf Kosten Deutschlands (diesmal zusätzlich durch den Euro bedingt) - in Saus und Braus gelebt hatten, und für die angeblich „so armen“ Banken gar nicht zu reden.

EUdSSR
Ideal und real existierende EUdSSR.
EUdSSR
Flagge der real
existierenden
EUdSSR.
Der Euro ist viel zu schwach für Deutschland und viel zu stark für die anderen Euroländer (Ausnahmen: Österreich, Holland, Belgien, Luxemburg). Er dient zwar dem Export, doch der hat steuermäßig mit Deutschland schon lange nichts mehr zu tun. Die globalen Unternehmen, egal wo ihr „Sitz“ ist, zahlen nichts mehr an die Nationen, in denen sie „sitzen“.
Euro ?  NEIN !
Dem Deutschen Volk nimmt die EU über Gesetze und besonders über den Euro nach und nach alles weg. Und dabei machen auch die Visegrad-Staaten mit - am meisten sogar. Die neuen EU-Staaten und diejenigen unter den älteren, die im Süden zu finden sind, profitieren am meisten von der Ausplünderung Deutschlands. Angesichts der Tatsache, daß nicht die Globalunternehmen mit Sitz in Deutschland, sondern nur die Deutschen als Volk selber darunter immer mehr leiden, vom Vermögen her gesehen mittlerweile sogar schon an letzter Stelle stehen innerhalb der Eurozone der 15er EU, fragt man sich doch nur noch: Wo ist die Solidarität? Die gab es immer nur auf der Seite des Gebers, aber nie auf der Seite der Nehmer. EU = Europas Untergang! Dieser Untergang funktioniert über die Ausplünderung Deutschlands. Ansonsten hätte es nie eine EU gegeben. Warum sind die angeblich „armen“ Nationen der EU so unsolidarisch? Weil sie nur an sich denken. Weil sie extrem nationalistisch sind. Weil sie nationalsozialistisch sind. Sie ziehen von Fremden Geld ab, um es in ihrer Nation sozialistisch zu verteilen, damit die Geldempfänger ihre nationalsozialistische Regierung immer wieder wählen.

Das wissen all diejenigen, die sich mit diesem Thema beschäftigt haben und einigermaßen „fit in der Birne“ sind.

Danke, Walter. Danke, Kathrina.

7354

Nationaler Widerstand?

Nie wieder EU !
Nie wieder EU !
Einverstanden! Doch der muß sich gegen den Globalismus richten. Die EU ist Bestandteil des Globalismus. Also muß sich der nationale Widerstand in Europa besonders gegen die EU richten. Genau das tun aber die angeblich den nationalen Widerstand vertretenden Visegrad-Staaten und im Grunde auch alle anderen Nehmerstaaten der EU nicht. Denn sie wollen den Profit aus der EU, und der kommt nun mal aus Deutschland.

Wenn also jemand meint, man sei bei der Bekämpfung der EU am besten beraten, wenn man gegen Deutschland wettere, dann ist das genau falsch. Denn mit Deutschland kann nur das in ihm lebende Volk, also das Deutsche Volk gemeint sein und nicht die in ihm ansässigen Globalunternehmen, die mit Deutschland überhaupt nichts mehr zu tun haben, sondern sogar im Gegenteil: die fordern ja auch vom deutschen Steuerzahler, nämlich über den deutschen Staat, und da aber in der EU die EU die Gesetze macht, wenden sich die Globalunternehmen gleich an die EU oder andere globalistische Organisationen.

Also noch einmal: Nationaler Widerstand? Ja, unbedingt! Aber nicht so! Nicht so, wie er uns von den Visegrad-Staaten vorgeführt wird.

Außerdem muß dieser Widerstand koordiniert werden. Und dafür braucht man wieder einen Anführer. Da der wieder derjenige mit der größten Wirtschaftskraft sein muß, kommt dafür ernsthaft nur die mit weitem Abstand größte Wirtschaftsnation Deutschland in Frage.

Das Geschrei geht dann wieder los: „Hilfe, wir werden unterdrückt!“ In Wirklichkeit sind diese Schreihälse selber die Unterdrücker, vergleichbar mit einem Kind, das seine Eltern tyrannisiert, weil es nicht genügend Süßigkeiten bekommt, und sie dann doch bekommt, weil die Eltern sich haben unterdrücken lassen.

Wenn nationaler Widerstand, dann muß von den Kleinen das Angebot an den Großen gemacht werden, den Widerstand anzuführen, ihn zu organisieren.

So - und nur so - kann es gehen. Aber ich weiß jetzt schon, wer das zu verhindern wüßte, wenn es zu einem echten nationalen Widerstand käme.

Festung Europa
Nie wieder Euro !  Nie wieder EU !
Trump macht es vor, nur mit dem Unterschied, daß sein Land ja schon bzw. noch national geeint ist. Europa ist nicht geeint, schon gar nicht national. Also kann der nationale Widerstand nur in interner Absprache und mit Zusammenhalt (nicht „Einheit in Vielfalt“ - das wäre wieder die Lüge der EU -, sondern Vielfalt in Einheit), sprich Nationen in einheitlichem Widerstand gehen.

Es geht um Europa.

Es geht nicht um die EU. Die EU tötet Europa. Die EU gehört mit zum Globalismus. Wenn beide so weitermachen wie bisher, dann wird Europa bald zur 3. Welt gehören. „Wandernde“ Teile der 3. Welt sind ja schon in Europa angekommen.

Wer aus der EU austritt, zeigt Solidarität mit Europa, wer in die EU eintritt, zeigt das Gegenteil. England konnte austreten, weil England auch auf andere Weise mit dem Globalismus eng zusammenarbeitet (Stichwort: „Finanzen“). Daß es für die anderen und besonders für die Melkkuh Bundesrepublik Deutschland schwierig ist, aus der EU auszutreten, ist bekannt. Dennoch muß gerade dieses Problem in Absprache angegangen werden. Warum gründen die europäischen Nationen nicht irgendwo, z.B. in Moskau, eine Exilgruppe des Widerstands? Ein Exileuropa wird es sonst per Zwang geben (Stichwörter: „Krieg“, „Flucht“, „Vertreibung“).

@) Dieser Text richtet sich vor allem an: Kathrina, Wirtschaftshistoriker, Werner N. und - last but not least - Walter.


NACH OBEN 1289) Alf, 27.08.2020, 19:59; Herr Schütze, 27.08.2020, 21:29, 21:34; Alf, 27.08.2020, 22:11 (7355-7358)

7355

@ Erwin Lottermann:

„Die »Elite der bundesdeutschen Offiziere« (Zitat @ Waltomax) bewies bereits in der »Affäre Günzel/Hohmann« (2003; HB) wie es um Korpsgeist, demokratische Gesinnung und Widerstandswillen aussieht. Auch sollte die völkerrechtliche Situation der BRD zur Diskussion stehen – war da nicht eine »Neuauflage« von Jalta im Gespräch? Fakt ist, die BRD ist kein Rechtsstaat, was u.a. »EU-Gerichte« mehrfach befunden haben. Sie ist es nicht und sie war es zu keiner Zeit. Was bereits ein Prof. Dr. Grimm vor Jahrzehnten so zutreffend beschrieben hat, erlebte der Autor nun aufs Neue – Politische Justiz, die im Sinne der Parteienjunta »Recht« spricht.“ **

Die Gesetze für die EU-Region, die dann in jedem einzelnen Mitgliedsland nur noch abgenickt werden, kommen zu mehr als 90 Prozent von der EU selbst. Und die daraus sich ergebenden Folgen sehen wir mittlerweile deutlich überall in der EU (Ausnahmen bestätigen die Regel nur). Das Militärwesen ist davon nicht ausgenommen, obwohl es in den meisten EU-Ländern der NATO unterstellt ist, doch die NATO ist nur anders schlimmer als die EU. Es wundert doch keinen mehr, daß die Welt auf Diktaturkurs ist, und zwar nicht erst seit der Corona-Verarschung. .... „Jalta“? Na, ja ....

Wenn aber „EU-Gerichte“ (ich wiederhole: „EU-Gerichte“ [siehe oben]) „befunden haben“, die Bundesrepublik sei „kein Rechtsstaat“ mehr, dann bedeutet das nur, daß die EU hocherfreut ist über den Erfolg des bei weitem mächtigsten EU-Landes. Die EU-Gerichte sind doch die rechtsstaatlosesten in der gesamten EU. Und das ist auch kein Zufall. Die gesamte Entwicklung hin zur Diktatur lief und läuft primär über Organisationen, nicht über Nationen, die nur als Blitzableiter fungieren. Die beschriebene Situation, die das Machtverhältnis zwischen Organisationen und Staaten (Nationen) widerspiegelt, ähnelt folgender Situation: „Ein Säbelzahntiger befindet, daß Hauskatze „Miesi“ auch eine Katze ist“.

In England wurde schon vor zehn bis zwanzig Jahren von einem englischen protestantischen Geistlichen gefordert, die Scharia im Vereinigten Königreich einzuführen.

Wir stecken in der Zwickmühle, denn es gibt einfach viel zu viele, die von diesem System profitieren. Wie ich schon im Zusammenhang mit den Wahlen gesagt habe: „Drei Viertel der Wähler der Blockparteien profitieren von ihrer Wahl“ (**|**) - Dummheit spielt bei den Wahlen nur eine sehr geringe Rolle. Und wenn Sie jetzt sehen, daß einerseits 75% der Blockparteienwähler auf der Seite der Blockparteien sind, die wiederum der EU und also den Globalisten totalitär untergeordent sind, und andererseits die hier massenweise eingewanderten Fremden ebenfalls auf der Seite der Globalisten sind, obwohl oder eher weil sie sich ein Kalifat oder eine Voodoo-Pimitivgemeinschaft wünschen, dann sehen Sie auch, wie die Schlinge um den abendländischen Hals immer enger wird.

Bei uns wird ja immerhin noch massiv demonstriert, auch wenn die Unterwanderung längst große Erfolge zu verzeichnen hat. In Australien und Neuseeland werden die Menschen auf offener Straße von Polizisten verprügelt, und zwar ziemlich brutal und aus willkürlichen Gründen, weil sie ja immer sagen können, sie hätten andere Menschen vor einer Person geschützt, die auf offener Straße keine Maske getragen habe.

Wir müssen den Blick immer zuerst auf das Äußere werfen, bevor wir das Innere kritisieren. Was also ist los in der Außenwelt? Wo wird was zu welchem Zweck gemacht? Und dann die Frage: Wie können wir uns positionieren, ohne Gefahr zu laufen, zum Präzedenzfall zu werden (wie Afrika oder Libyen und Syrien [Krieg], dann China [Wuhan], gegenwärtig Australien und Neuseeland [Maskenmegaterror])?

Vielleicht kann man auf eine USA-China(-Rußland)-Verbindung setzen, die dann mit und in dieser EU endlich aufräumt, aber auf die EU selbst konnte und kann man keinen Pfifferling setzen.

Die Staatsfunkproblematik, so schlimm sie auch ist, ist im Vergleich zu den ganz großen Problemen (Bevölkerungsreduktion durch Krieg, Impfung, Krankmachung, Hunger u.ä.) sekundär. Wir dürfen nicht vergessen, daß z.B. in den USA, UK, Kanada, Australien, Neuseeland auf den Staat immer schon gepfiffen worden ist (sogar die FED ist privat!), weil sie sich immer schon mehr als Gesellschaften denn als Staaten verstanden haben, was aber nicht mehr, sondern weniger Rechte der Einwohner bedeutet. Diese Länder sind immer schon sehr privat und somit globalistisch gewesen.

7356

Mein Kommentar war nicht an Sie gerichtet.

Ich bin auf das Thema sehr wohl eingegangen, auf andere Kommentare als den Ihrigen Kommentar aber auch. Ansonsten hätten Sie sich auf meinen Text gar nicht beziehen können. Wollen Sie die anderen Kommentare etwa auch zensieren? Und die Sache mit dem Nationalsozialismus ist eben nicht „indiskutabel“, wie Sie sagen, denn dieses Wort ist das einzige Wort, das in dem genannten Zusammenhang zutrifft.

Ich nehme an, daß Sie zumindest von Ihrem Herzen her dem Wort „nationalistisch“ zustimmen würden. Doch warum dann nicht auch dem Wort „sozialistisch“? Die EU ist sehr, sehr, sehr sozialistisch. Und Sie sind in der EU und wollen auch in der EU bleiben, fahren aber trotzdem einen Nationalismus. Beides zusammen - Nationalismus und Sozialismus - ergibt eben Nationalsozialismus. Das ist logisch. Ich habe das ja nicht ethisch gemeint, sondern logisch.

Entscheiden Sie darüber, wer welche Wörter verwenden darf? Das wäre schon Zensur!

Würde mich hier und angesichts der Tatsache der EU-Diktatur nicht wundern, denn die EU hat überall Zensur erlaubt, und ihr ist es egal, ob die nationalistisch bzw. nationalsozialistisch oder international bzw. internationalsozialistisch erfolgt - Hauptsache, sie erfolgt überhaupt und richtet genug Chaos an. Darum geht es den Globalisten. Sie wollen mittels Chaos, das sie stiften und überall hinterlassen, von ihrer totalitären Diktatur ablenken, um sie weiter ausbauen, vertiefen, verschärfen zu können.

7357

@ Walter:

„Die Behauptung des Foristen Hartwig ... ist der größte Unsinn den dieser hier kommentiert hat. .... Daß es mit seinen wissenschaftlichen Kenntnissen nicht weit her ist habe ich ihm schon mehrfach bewiesen. .... Einem Foristen Hartwig, welcher hier öfter als Religionsfanatiker auftritt, muß sich doch selbst die Frage stellen, ob er diesen klaren Menschenverstand auch vorzuweisen hat. Von einer freien und höflichen Diskussionskultur wie er sie in These 5 fordert - kann bei seinen mit manchmal bösartigen und beleidigenden Äußerungen gespickten Kommentaren nicht die Rede sein.“ **

Auch zieht er vieles aus dem Zusammenhang, dreht dieses dann um in eine andere, zumeist seine eigene falsche Aussage, ignoriert das Wesentliche an den Aussagen, die er zu kritisieren meint, und glaubt, andere Menschen könnten geschriebenen Text hören. Wer will schon mit so einem reden? Ratschlag: Nicht beachten!

@ Kathrina und Wirtschaftshistoriker. **

Es ist völlig richtig, wenn Sie verlangen, die 1918 begonnene Ausplünderung Deutschlands müsse endlich aufhören. Statt dessen ist sie immer schlimmer geworden. Vom „Versailles mit Krieg“ zum „Versailles ohne Krieg“ (François Mitterrand). Das bedeutet: Vom Versailler Diktat bis zum Euro-Diktat. Wir Historiker wissen das.

Auch sollte sich der nationale Widerstand über die Notwendigkeit eines Austritts aus der EU klar sein. Alles andere wäre widersprüchlich, geheuchelt, verlogen. Absahnen und den, von dem abgesahnt wird, auch noch als den Schuldigen hinstellen, um weiter absahnen zu können, ist ethisch unverantwortlich, ein Verbrechen.

Die EU lockt bei echten und unechten Austrittswünschen sofort mit Geldzahlungen - Geld, das die deutschen Steuerzahler bezahlen -, doch dieses Angebot darf bei echtem Widerstand keiner der am nationalen Widerstand Beteiligten annehmen, ansonsten ist es kein Widerstand, sondern das eben schon erwähnte widersprüchliche, geheuchelte, verlogene Muster, nach dem alle Nehmer aus der EU vorgehen - und auch immer mehr auf der Seite des Gebers Deutschland, weil sie von denjenigen bezahlt werden, die ein starkes Interesse an der Beibehaltung der Ausbeutung Deutschlands haben. Also findet auf der deutschen Seite des Widerstands von Anfang an auch noch eine Unterwanderung statt. Dadurch wird der Widerstand geschwächt und dabei in eine andere Richtung gelenkt. Das zeigt sich auch bei den derzeitigen Demonstrationen. Dort reden fast nur noch solche, die entweder selber Unterwanderer oder solche sind, die sich der Unterwanderung bereits geopfert haben - mit oder ohne Bestechungsgelder.

Ich könnte hier eine Menge an Namen nennen. Diese Unterwanderung findet selbstredend auch im Internet statt. Auch dafür könnte ich eine Menge an Namen nennen.

All das läuft über das Geld. Das Geld bestimmt die Geschichte. Wie lange noch? Das ist die entscheidende Frage.

7358

@ Herr Ludwig:

„@ Alf:

„Die Staatsfunkproblematik, so schlimm sie auch ist, ist im Vergleich zu den ganz großen Problemen (Bevölkerungsreduktion durch Krieg, Impfung, Krankmachung, Hunger u.ä.) sekundär.“ ** **

Die einseitige, verzerrte und propagandistische Berichterstattung des Staatsfunks ergreift zentral manipulierend das Bewusstsein der Menschen, so dass die »ganz großen Probleme« von den Menschen gerade im gewünschten Sinne gesehen, geduldet, unterstützt werden. Der Krieg z.B. wird immer erst von den Medien mental vorbereitet. (**).“ **

Nein, nein, nein. So habe ich das nicht gemeint. Denn ich habe nicht gesagt, daß die Staatsfunkproblematik nichts mit den großen Problemen zu tun hätte, auch nicht, daß sie vom Staatsfunk nicht propagandistisch verbreitet würden. (**|**). So etwas würde ich nie sagen. Das ist doch völlig klar, geht auch aus dem, was ich hier beim Fassadenkratzer sonst noch so getextet habe, hervor.

Der Krieg wird erst einmal geplant. Die Medien verbreiten ihn, planen ihn aber nicht. Für die Planung sind wirklich andere zuständig. Sie glauben ja gar nicht, wie sehr z.B. in Unternehmen geplant wird. Die Medien suggerieren, daß Staaten planen, aber nicht Unternehmen. Und auch das ist nicht wahr.

Es sind private Unternehmen, denen Banken und andere Unternehmen, darunter auch die der Medien, gehören und die Kriege, Weltbevölkerungsreduktionen, Weltbevölkerungsimpfungen, Weltbevölkerungsernährung, Weltbevölkerungshunger u.v.a. planen.

Wir können ja einmal ein Gedankenexperiment starten: Wir nehmen die Medien weg und schauen, was die globalistischen Planer machen. Aufhören zu planen? Nein, Irrtum! Sie werden mit der Planung weitermachen und neue Medien ins Leben rufen, doch die wollten wir uns ja wegdenken, also werden die Globalisten selbst die Propaganda betreiben. Aber die Planung werden sie keinem anderen überlassen als nur sich selbst.

Was Sie meinen, ist die mentale Vorbereitung, doch die ist nicht der Anfang. Sie können die Medien nicht als Planer hinstellen. Waren bei den Totalitaristen des 20. Jahrhunderts die Diktatoren oder die Medien die Planer und Entscheider? Die Medien haben viel Macht, aber die Entscheider haben mehr Macht, und zwar nicht nur in Diktaturen.

Ich meinte also mit dem Adjektiv „sekundär“ (**|**) wirklich „zweitrangig“ in der Machthierarchie. Und „zweitrangig“ bedeutet ja nicht „zehntrangig“.

Keine Angst, ich unterschätze die Medien schon nicht, wie ich auch an vielen Textstellen hier beim Fassadenkratzer gezeigt habe.

 

NACH OBEN 1290) Alf, 28.08.2020, 01:59, 23:59 (7359-7360)

7359

Waren die Führer der Sowjetunion mächtiger als ihr Zentralorgan „Prawda“? („Prawda“ bedeutet, wenn ich mich recht entsinne, „Wahrheit“ - klar, daß die Prawda nicht die Wahrheit, sondern die Lüge verbreitet hat.)
Europa in Gefahr
War der Führer des 3. Deutschen Reiches mächtiger als sein „Völkischer Beobachter“ und die lange vor seiner Machübernahme begonnenen Sprachfunkdienste? (Am 1. September 1922 begann der Sprachfunkdienst, am 15. Mai 1925 wurde in Berlin die Reichs-Rundfunk-Gesellschaft mbH [RRG] gegründet.) Waren und sind die Globalisten mächtiger als diejenigen Medienanstalten, die ihnen gehören, ob direkt (Unternehmen) oder indirekt (staatliche Einrichtungen)? Sie bestimmen auch den Staatsfunk in allen Erdteilen, Teile Asiens ausgenommen. Ob indiekt oder direkt: die Globalisten bestimmen die Judikative, die Exekutive, die Legislative, die Medikative (meine Wortschöpfung - ich meine die Medienmacht), mit anderen Worten: sie bestimmen Justiz (Gesetz bzw. Recht), Politik (Regierung und Parlament) und Medien (Vermittlung nach außen, an das Volk).

Planung ist eine rein interne Angelegenheit, während die Vermittlung von Information zwischen dem Inneren und dem Äußeren die Angelegenheit ist, für die die Medien zuständig sind. Medien planen nur in ihrem Zuständigkeitsbereich, ansonsten sind sie nicht für die Planung, sondern eben für die Vermittlung zuständig. Will also z.B. eine Zeitung ihre Strategie planen, so kann sie das tun, aber nur in ihrem Rahmen. Wenn derjenige, dem diese Zeitung gehört, nicht will, daß seine Zeitung die Planungen ihres Herrn verrät, dann wird diese Zeitung das mit an Sicherheit grenzender Wahrscheinlichkeit auch nicht tun.

Und wenn z.B. Soros und Gates interviewt werden, merkt man auch nicht ihnen, sondern eher den Interviewern Nervosität an. Die beiden geben munter zu, was sie so vorhaben, was sie einst getan haben (Soros z.B., daß er Mitjuden an die ungarische SS verraten hat - seine Begründung: „Hätte ich es nicht getan, hätte es ein anderer getan“ [*grins*]). Nicht nur fällt auf, daß beide gegenüber den Medien selbstsicher sind, sondern auch, daß sie dabei stets amüsiert sind und sich ein Grinsen keinesfalls verkneifen. Denen gegenüber stellen Medien keine Macht dar.

Ähnlich verhält es sich mit den globalistischen Geostrategen (z.B. die des „Informationsdienstes“ [sic!] „Stratfor“). Auch sie machen überhaupt keinen Hehl mehr daraus, offen zu sagen, was sie beabsichtigen. Sie wissen, daß ihnen über die offziellen und auch inoffiziellen Medien nichts passieren wird.

Primär ist die globale Macht nicht staatlicher, sondern privater Natur. Das ist schade, aber wahr.

Trump und andere Staatsherrscher sind dabei, dem Staat wieder mehr Macht zukommen zu lassen. Ob sie erfolgreich sein werden?

7360

@ Waltomax:

„Wenn Putin und Trump angeblich einen Friedensvertrag mit Deutschland wollen, dann stünden sie einem sauberen Militätputsch seitens der Bundeswehr doch sicher offen gegenüber!“ **

Wenn die Betonung auf dem Adverb „angeblich“ liegen soll, wenn also Trump und Putin nur „,angeblich‘ wollen“, dann wollen sie ja nur angeblich, also nicht wirklich. Aber ist das so? Kai Ahnung weiß es wahrscheinlich auch nicht.

Wir dürfen nicht vergessen, daß Trump und Putin „ganz schön“ unter Druck stehen. Im Moment sieht es nicht so aus, als würden sie, sondern so, als würde Merkel gewinnen. Doch das kann sich auch noch ändern. Klar!

Ich mochte das Ferkel Merkel übrigens noch nie. Schon als sie von Kohl als „sein Mädel“ selektiert zu sein schien (in den frühen 1990er Jahren), war mir klar, daß diese Kommunistin uns mehr als nur schaden würde.

@ Waltomax:

„Und holt Merkel endlich aus dem Kanzleramt ....

Sieferle hatte wohl recht.

FINIS GERMANIAE.“ **

EUROPA
SCHAFFT
SICH
AB

Recht hatte nicht nur er, sondern auch Sarrazin; ABER: Beide haben nicht „über den Tellerrand geschaut“, weshalb Formulierungen wie „finis Germaniae“ und „Deutschland schafft sich ab“ zu kurzsichtig ausfallen (übrigens hat auch Gunnar Heinsohn die Formulierung „finis Germaniae“ gebraucht), DENN:
Europa in Gefahr
Hätten sie „über den Tellerrand geschaut“, dann hätten sie die Formulierungen „finis Europae“ und „Europa schafft sich ab“ gewählt.

Deutschlands westliche Nachbarn haben schon eher als Deutschland mit der nationalen Abschaffung angefangen, weshalb Deutschland gar nicht die Möglichkeit mehr hatte, damit anzufangen, sondern lediglich die Möglichkeit, seine westlichen Nachbarn einzuholen. Jedenfalls ist eine Abschaffung im Alleingang einer Nation sehr unwahrscheinlich, weshalb Sieferles und Sarrazins Beschreibungen nichts anderes meinen können als den Untergang des Abendlandes, dem wir weiterhin beiwohnen. Dieser Untergang ist ein Prozeß mehrerer Jahrhunderte, und er ist noch nicht zu Ende. Meiner Einschätzung zufolge werden wir bestimmte Personen gegeneinander kämpfen sehen, wie es jetzt schon ansatzweise zu sehen ist, und dieser Kampf wird längere Zeit dauern. Da dieser Kampf aber, wie ebenfalls heute schon zu sehen ist, den gesamten Globus betrifft, sind selbst die beiden Formulierungen „finis Europae“ und „Europa schafft sich ab“ sogar noch zu „eng“, wenn die gesamte Welt und somit die gesamte Menschheit bedroht ist: „finis mundi“ und „die Menschheit schafft sich ab“ müßte es dann heißen.

Ob die Menschheit dabei ist, sich abzuschaffen, und die Welt bald am Ende sein wird, weiß ich nicht, aber ich weiß, daß Europa dabei ist, sich abzuschaffen, und darum vielleicht bald am Ende sein wird.

Die EU tötet Europa. Also muß entweder eine andere EU her, nämlich eine europafreundliche an Stelle der jetzigen europafeindlichen EU, oder die EU vernichtet werden, damit Europa endlich erwachen, zur Welt kommen kann. Ansonsten:

FINIS EUROPAE.

 

==>

 

NACH OBEN

www.Hubert-Brune.de

 

 

WWW.HUBERT-BRUNE.DE

 

NACH OBEN